Jump to ratings and reviews
Rate this book

Schismatrix Plus

Rate this book
Schismatrix Plus, is Bruce Sterling's new trade paperback. For the first time in one volume: every word Bruce Sterling has ever written on the Shapers-Mechanists Universe.

In the last decade, Sterling has emerged a pioneer of crucial, cutting-edge science fiction. Now Ace Books is proud to offer Sterling's stunning world of the Schismatrix--where Shaper revolutionaries struggle against aristocratic Mechanists for ultimate control of man's destiny. This volume includes the classic full-length novel, Schismatrix, plus thousands of words of mind-bending short fiction.

319 pages, Paperback

First published December 1, 1996

513 people are currently reading
6303 people want to read

About the author

Bruce Sterling

356 books1,200 followers
Bruce Sterling is an author, journalist, critic and a contributing editor of Wired magazine. Best known for his ten science fiction novels, he also writes short stories, book reviews, design criticism, opinion columns and introductions to books by authors ranging from Ernst Jünger to Jules Verne. His non-fiction works include The Hacker Crackdown: Law and Disorder on the Electronic Frontier (1992), Tomorrow Now: Envisioning the Next Fifty Years (2003) and Shaping Things (2005).

Ratings & Reviews

What do you think?
Rate this book

Friends & Following

Create a free account to discover what your friends think of this book!

Community Reviews

5 stars
1,766 (34%)
4 stars
1,736 (34%)
3 stars
1,156 (22%)
2 stars
333 (6%)
1 star
103 (2%)
Displaying 1 - 30 of 274 reviews
Profile Image for Terry .
449 reviews2,196 followers
May 8, 2013
What a great read this was. I've never been much of a fan of cyberpunk and I'm not particularly a fan of the authors generally noted to be founders of the genre (William Gibson, Neal Stephenson, etc.), but I really loved this book and it has put Bruce Sterling near the top of my list for sci-fi writers. Sterling does an excellent job of melding his cyberpunk ethos with a space opera-ish background that is combined with the 'Grand Tour' of the solar system structure (cp. The Ophiuchi Hotline by John Varley or Vacuum Flowers by Michael Swanwick) to create a really delectable sci-fi romp. (Though perhaps "romp" isn't quite the right word.)

_Schismatrix Plus_ is composed of the novel _Schismatrix_ along with all of the published short stories in the same Shaper/Mechanist universe (I wish there were more). The Shapers and Mechanists are the two major offshoots of humanity who have colonised the solar system in a slower-than-light-speed cosmos. The Shapers are a faction devoted to the improvement of the human form and mind through genetic engineering and are known for their somewhat aristocratic and elitist bearing, while the Mechanists are those who instead chose the path of merging the human form with machine technology in the quest for immortality and transcendance. The Earth kicked both factions out at some point in the past and is now considered interdicted by both.

In _Schismatrix_ itself we follow Abelard Lindsay, an aristocrat from one of the earliest space habitats orbiting the moon, who was sent to be trained as a Shaper 'diplomat' in his youth and who is ultimately betrayed by his childhood friend and colleague Philip Constantine as they try to overthrow the gerontocracy of their republic (not really a spoiler as this happens early in the book and is the main impetus for the plot). Lindsay is sent into exile and thus begins his great tour of the solar system where he comes across many of the human factions and organizations vying for power.

The solar system that Sterling creates is a colourful one and is filled with interesting characters and groups, some aligned with one or the other of the Shapers and Mechanists, and some looking out only for themselves. These include a prostitute/banker who becomes an ecosystem in herself, a playwright-Mechanist, a group of space pirates who are also their own nation-state, and a clan of Shaper terraformers. Throughout his adventures Lindsay is both shaped by, and shapes, the human ecumene around him, at first simply trying to survive and later working towards fulfilling his great dreams for a post-human future for humanity. Added into this heady mix is a first contact with aliens that throws off the detente of the Shaper-Mechanist war. The story really is a tour de force as we follow Lindsay's rising and falling fortunes and get a glimpse of wide swathes of the fascinating human solar system created by Sterling.

Sterling's world is further fleshed out by the short stories included here: "Swarm" - a chilling tale of Shaper meddling in things best left alone, "Spider Rose" - the tale of a Mechanist loner who gets more than she bargains for when she trades with aliens, "Cicada Queen" - the story of an innovative Shaper that ties in with some of the events of _Schismatrix_, "Sunken Gardens" - a tale of competition and terraforming to achieve a new post-human dream, and "Twenty Evocations" - a somewhat experimental story detailing snapshots of the life of the Shaper Nikolai Leng.

Alastair Reynolds has acknowledged his debt to Sterling in the creation of his own "Revelation Space" universe and I'm a little surprised that there aren't more sci-fi writers mining the myriad of ideas that Sterling throws off with seeming effortlessness in these stories. This really is a great ride and is highly recommended for lovers of sci-fi.

Also posted at Shelf Inflicted
Profile Image for Guillermo  .
80 reviews97 followers
July 25, 2016
The moment I read in Galactic North that Alastair Reynolds acknowledged Schismatrix as a huge influence in developing his Revelation Space series, I knew I had to eventually track it down. Four years later, eventually finally happened.

So let me first of all clarify the difference between Schismatrix and Schismatrix Plus. The Plus edition has five short stories set in the Schismatrix universe along with the novel length title story. These short stories were enjoyable- especially Swarm which brought to mind Peter Watt's excellent Blindsight in its treatment of a bizarre alien hive intelligence perhaps even more chilling than the Scramblers.

Overall, I enjoyed Schismatrix Plus, but I had some issues which dropped it from the four or five star book I initially thought I was reading. First the positive: this is such an ambitious and imaginative work that only manages to occasionally feel dated for its thirty year age. The ideas in this book come flying at a furious pace as it chronicles the life of an ambitious aristocrat navigating his way through a solar system where post humanity has split into various factions vying for power. There is no singular post humanity in Sterling's universe, there are several clades of humanity. Imaginative, unforgettable, and even absurdly comical scenes are in abundance on this odyssey.

The problem is that Schismatrix reads like a loose collection of short stories. The nebulous plot consists of the protagonist trying to outsmart and play the factions against each other through a diverse setting of locations and times in the Solar System. But here is the problem. Schismatrix is like a trying to eat a dozen colorful donuts on your own - at first a delightful enterprise but after a couple, your taste buds are worn out and it starts becoming a tad tiresome. Schismatrix lacks substance and instead is only propelled by Sterling's vertiginous ideas. There was simply no reason to care and no one to really care for in this long journey, which is why I have to give it no more than three stars. I still believe it's worth a look if you are not dissuaded by what it lacks, and are interested in a challenging and wild reading experience.
Profile Image for Charles.
616 reviews117 followers
September 28, 2024
Cyberpunk/political/space opera crossover, picaresque novel. In which Abelard Lindsey born amongst humans who have fled a dead Earth are living in artificial habitats, asteroids and moons, eventually a few of them live long enough to become Posthuman .

description
O’Neill cylinder-style habitat like the Mare Tranquillitatis People’s Circumlunar Zaibatsu

My yellow paged, dead tree, trade paperback version was a modest 319-pages. It had a US 1996 copyright.

Bruce Sterling is an American science fiction author. He has written more than ten novels, and numerous works of short fiction. This was the author’s third and breakthrough novel. I have read almost all the author’s books, including previously this one. However, I can’t recall the last one I read in the dim past.

I found this yellowed paperback low on a crowded shelf of a used bookstore I was prowling. I remembered reading this the first time in the static-laced, black leather, mirror shades and brushed stainless heyday of the now dead Cyberpunk genre. I barely remembered the story, but did remember it causing my eggshell, fragile mind to asplode. In that dimly lit, aisle, amongst dusty, shelves crammed with old books, its time had come again.

Note, I read the Schismatrix Plus version of the book with a 1996 copy write. This bundles the original novel of 236-pages, with the five short stories Sterling wrote in the Schismatrix Universe 11-years after the novel’s publication. The short stories are not included in this review.

TL;DR Synopsis

Abelard Lindsay, a young, dilettante of good family and Shaper-trained diplomat of a neutral circumlunar hab, falls afoul of local politics in the Shaper (psychologists and bio-engineers) and Mechanist (technocrats) factions Cold War rending the Solar System.
”The Shapers, the Mechanists—those aren’t philosophies, they’re technologies made into politics."
He sundogs it, escaping outward into the system, surviving, succeeding and failing, whilst changing vocations, identities, and locations over two centuries. In the process, he changes, whilst affecting the far-future human history in times of even greater change.

The Review

Schismatrix is vintage cyberpunk. It starts with the classic disorientation of the reader à la William Gibson. You’re thrown headlong into the deep-end of the world building pool with your clothes on, wallet and mobile still in-pocket. You need to figure out a lot of what has gone on-before by yourself—quickly. This includes puzzling out a very inventive new vocabulary. Some folks hate this. It’s likely why Cyberpunk was extirpated from main-stream science fiction? I chowed on it. I would have been a Mechanist in the novel.

Writing was good, close to excellent. The narrative was in a fractured chronological order. Some chapters followed closely, others could be decades apart. The narrative starts in lunar orbit, and reaches Jupiter’s moon Europa after about 200-years. There was a short diversion sunward to the proscribed Earth. Descriptive narration was highly imaginative, and richly detailed.
They had that peculiar Shaper magnetism, an acrobatic smoothness and fluidity. Yet something in the set of their shoulders, their slim, dexterous hands, kinetically displayed Constantine’s genetic heritage. They wore outlandish finery: round velvet hats, ruby earrings, and gold-laced brocade coats.
Action was likewise good. Although, this was not an action-heavy novel. Dialog was terse in comparison.
”There is no war. This is evolution in action.”
In addition, the writing was well-groomed. I found only one mistake. The old Timey Arbor House publishers, who published a lot of the original cyberpunk, had good editors.

One thing I noticed with this almost 40-year old novel, was how complete a story the author told using a scant 236 pages. It’s rare to find a contemporary science fiction novel with less than 350 pages. I’ve even been exposed to several recent sf novels with 500-1000 pages by first time published authors. Forty years ago, talented authors, knew how to do more with fewer words.

Picaresque novels are written in the first person, that being the protagonist Abelard Lindsay’s POV. Contrary to the novel's type, the Lindsay character develops significantly over 200-years, abetted by rejuvenations and Mech hardware. Lindsay’s politics change several times. He goes from a young Shaper activist, to a Mechanist, to different flavors of Independent, and finally an elder, Posthumanist. In the process, he makes and leaves behind: friends, allies, enemies, wives and lovers. The elderly, cyborged and meticulously medicated senior statesman character at the end was unrecognizable as the young Shaper con-man, surviving by his wits of the story’s beginning.

Plotting. Picaresque novels are a loosely plotted series of adventures. Lindsey’s adventures advance outward from the sun, taking place on artificial habitats, asteroids, and moons. Sometimes the location is used only briefly, and others it’s for decades. Each location addresses a change in: human politics, societal evolution or Lindsey himself. A few times, it’s Lindsey affecting the political change. In others it’s Lindsey who’s changed or was changing. I noted an interesting theme on Aging as the story got long too.
They believed in what they saw in him: an older man, a bit slow, perhaps, without the fire of genius others had, but generous and with the tang of mystery. With that mystery came glamour: Doctor Abelard Malvrides [Lindsey] had set his share of trends.
Typically, I eschew story’s with a lot of venue changes. Here with a novel containing the theme of change, I saw the value of them. At the end, I was surprised by both a crucial reveal, and Lindsey’s last story choice.

There was: “Sex, drugs, and rock’n roll music, along with violence in the story.

Folks had sex. It was tastefully done, although it was of the fade-to-black type. Sexuality was part of the narrative, but it was always heterosexually oriented. The fluidity of gender or non-gender found in modern sf was almost completely absent from the story. I found this unaccountable considering the degree of societal and biological change described. Intoxicants, particularly synthetic drugs were widely in use. In general, there was a bewildering array of medicinals in-use. Old fashioned alcohol was consumed in social settings, sometimes in excess. Music was almost pervasive in social situations. In ranged from the ancient (Classical) to the undescribed then contemporary.

The body count was modest. This was despite a centuries Cold, sometimes Hot war going on. I frankly thought that there would likely have been more deaths by malice or misadventure? Vacuum Kills!. Most of the violence in space vessels or habitats was physical, or impact weapons to avoid holing the environment. The violence was moderately graphic. As the story got long the majority of it was Administrative Violence.

World building was exceptional in its breadth and detail. Several of the technologies were “sufficiently advanced technologies indistinguishable from magic”. Many elements of the world building have since become tired tropes. Others left me wondering, whey they didn���t have legs. However, there were a few anachronisms that survived. For example,
An adhesive coffee table held a flip-top inhaler and a rack of cassettes.
A sticky horizontal surface in low-gravity habs was a brilliant idea. Although, Sterling's future had a fondness for the now defunct tape storage. I also would have thought that something better than Velcro® would have been invented? Finely, early in the story, Lindsey sports a credit card which was really no different than the chipped card in my wallet. These artifacts existed alongside more prosaic future technologies that are still nearer now than they were in the story. (Like compact tokomaks.)

Summary

I’m a fan of old timey cyberpunk. I loved this book. It’s a story contemporary with Neuromancer , although it’s more like Vacuum Flowers (my review) in its space opera aspect.

You may have noticed I was generous with quotes in this review? The story was also very well written in that edgy and gritty style cyberpunk borrowed from hardboiled. I’m glad I Eye-read this, so I could, at points, linger over the prose.

The author packed an enormous amount of ideas into 236-pages. The story was also an embarrassment of world building riches. Just about every chapter contained one.

However, the book was an artifact of science fiction at its time (1985). Politics, technology and human limitations are not popular themes in contemporary science fiction. Whilst themes absent from this book, like gender now are. In which case, reading it felt fascinatingly, old fashioned, like viewing a Tesla coil .

Still I really liked it. It was packed full of ideas and a great piece of narrative craftsmanship. A recommended read for those interested in artifacts of a bygone science fiction genre.
Profile Image for Claudia.
1,013 reviews775 followers
June 14, 2016
Alastair Reynolds said, in one of his Revelation Space books, that Bruce Sterling’ Schismatrix had a huge influence on his works and recommends it as one of the best cyberpunk stories. Of course it piqued my interest and now, after I read it, I have to say he was right - at least about the influence part.

It is obvious that Shaper/Mechanist universe stands at the base of Conjoiners/Demarchists one and that the somber atmosphere is the one encountered mostly in Chasm City. But the similarities between the two end here. World building is almost nonexistent in Schismatrix but present to some degree in his short stories which are set in the same universe. Also, the action starts too sudden, without preparing the reader for such a turn of events and the strange inhabitants of an even stranger world; I missed the gradual immersion of Reynolds’ style. I guess being AR’s fan didn’t help much.

In fact, the whole time I got the feeling that Bester’s Deceivers got lost in Chasm City, lol.
They took my womb out, and they put in brain tissue. Grafts from the pleasure center, darling. I’m wired to the ass and the spine and the throat, and it’s better than being God. When I’m hot, I sweat perfume. I’m cleaner than a fresh needle, and nothing leaves my body that you can’t drink like wine or eat like candy.”

The Zaibatsu recognizes one civil right: the right to death. You may claim your right at any time, under any circumstances. All you need do is request it. […]
“Do you wish to claim your civil right?”
“No, thank you”, Lindsay said politely. “But it’s a great solace to know that the Zaibatsu government grants me this courtesy. I will remember your kindness.”

As for the short stories, Swarm and Spider Rose deserve 5 awesome stars.

And even if Sterling’ style doesn’t exactly match my taste, I really enjoyed his sharp irony and subtle humor and I have to give him credit for the imagination. Had I have read it before Revelation Space I would have been stunned by it. After all, he’s not being considered one of the cyberpunk's founders for nothing.
152 reviews30 followers
May 27, 2013
A bizarre absurdist bourgeois epic set in the space kindgom of the posthuman con artists. Features hyperbole and sharp dark humor.

As scientific and technological advances shatter the limitations which define modern thought and sustain the existence of a single human community, rugged individualists and pretentious youths boldy reach for transcendance.
But as it turns out, it's bourgeois property relations which end up transcending the material conditions that sustained them. Commodity fetichism doesn't even begin to describe this. Freed from all material and social limitations to imprint their mystical freedom on a boundless cosmic blackboard, people file patents and trade stocks. Nobody is in a position to actually enforce these property claims but people organize their lives around them anyway. And so genetically-engineered super-Ponzis enjoy unfettered power over people's lives and homes.
Do not fear: this book has a high irony content. This Austrian economic cult seems to be a product of cosmic evolution. Indeed, in Schismatrix's universe the only thing that seems to allow advanced cultures to exist for long is this sort of capitalist nonsense. Cultures which are not obssessed by it find something better to do than existence, you see. Therefore pointless interstellar markets exist. Because "futility is freedom".
Or something.
Sterling is so deadpan with this stuff I don't know what he was thinking. I do hope it's some kind of satire.

Nonsense and cool existential musings aside, this book is crammed with nice SF concepts and fun and/or dirty details. If you don't mind all those quaint data tapes, that is.
But it's disjointed, uneven, aimless and (as you might have guessed by now) fundamentally implausible.
Parts of the book are simply nuts. It's also a difficult read at times and a couple of scenes are borderline incomprehensible.
All that said, Schismatrix is not 100% silly. Serious issues are alluded to and stimulating ideas are shared with the reader.

This book is also noteworthy for beign influential among hardcore genre practictioners.
Alastair Reynolds' much more reasonable new series (as far as the first installment is concerned anyway) owes much to it for instance.
Profile Image for Adam.
558 reviews435 followers
March 2, 2010
I had written Bruce Sterling off as a relic of the cyberpunk era, big mistake. The wow factor is pretty big on this. Mind mutating, WTF, idea per sentence science fiction with shades at time of Bester, Triptree jr. Delaney, Barrington J. Bailey(who blurbs it) William S. Burroughs, and Ballard. Dense, filled with absurd humor and grotesque surreal visions, as human future and form breaks and cascades into increasing odd shapes. I feel a little buzzed after finishing this. This and a couple of short stories have put Sterling on my favorites list. This book also had a profound influence on the books of Charles Stross and Alastair Reynolds, the former taking the zany idea flinging and economic speculation and the latter the grim, fractured weirdness.
Profile Image for Stuart.
722 reviews341 followers
May 17, 2022
Neutron Star-Dense Cyberpunk, Hugely Influential, Hard to Digest
Back in the 1980s, it was William Gibson's Neuromancer (1984), Bruce Stirling's Schismatrix (1985), Walter Jon Williams' Hardwired (1985), and Neal Stephenson's Snow Crash (1992) that gave birth to the concept of cyberpunk, shaking things up by mixing dystopian themes with the latest technology extrapolation, early iterations of the internet, cybernetic enhancements, hackers, AIs, and so forth. And of course the excellent later cyberpunk novel Altered Carbon (2002) by Richard Morgan owes a huge debt. But of that group, Sterling's Schismatrix is actually a lot more, it really goes galactic and post-human and explores themes that of human genetic and technological advances that bring mankind closer to the singularity, again before that terms was bandied about so frequently. It apparently was a major influence of the SF creations of Alastair Reynolds and Charles Stross as well.

So it's a bit sad that this was the only full-length outing that Sterling wrote about his Shaper-Mechanist universe, along with a series of excellent short-stories written previously that are included in Schismatrix Plus, namely "Swarm", "Spider Rose", "Cicada Queen", "Sunken Gardens", and "Twenty Evocations". There was enormous potential to expand on any of the seething mass of ideas that are jam-packed into this small but ultra-dense novel that still feels like a serious of vignettes, brief glimpses of a cold and scary post-human universe, ala Alastair Reynolds.

While it gets full marks for its brilliant ideas, free-wheeling extrapolation, and diamond-hard prose, it is also almost unreadable at times, given how much is packed into such tight passages and episodes. There is also a lot of implausible far-future developments, and of course a severe lack of relatable characters just like William Gibson, but then again that is a defining characteristic of cyberpunk in my view, as it's fundamentally dystopian and often a warning of what might happen if we surrender ourselves to AIs, technology, and hyper-capitalism at the expense of our humanity.
Profile Image for Andrew.
140 reviews10 followers
July 21, 2008
Another goodreads reviewer wrote: "It is creative, but one of the characteristics of this book is that the author writes as if the story is happening in our present world, so he does not define words and key elements just as an author writing in the present wouldn't define terms they assume are collective knowledge." They gave this book one star. One star!

It's times like these I realize how crazy some people are. The above technique is one of the marks of good science fiction, as opposed to the forced and schlocky shit people think of when they think of "science fiction".

Anyway, in protest of this confusing and misguided review, I'm upping my rating to five. I have only fond memories of Schismatrix Plus. Cockroaches! Space pirates! Zero-G martial arts! Terrible bacterial infections! Genetically-engineered hookers!

I guess "it was amazing".
Profile Image for Brent.
374 reviews189 followers
June 7, 2023
Slow moving but interesting. This is definitely a different stream of cyberpunk that I am used to.

The long saga time-span of the story gave it a hint of Foundation era Asimov that is unusual for this genre. The ending gave the whole thing a touch of sentimentality that I associate with Bradbury. (also unusual for this genre)

These add some unusual spice to what would normally be a sleek and fast-moving projectile of a story.
Profile Image for Michael Burnam-Fink.
1,702 reviews304 followers
May 31, 2025
This is it. This is my very favorite book, one of the immortal classics of 20th century science fiction, and a work that is as live and thrilling as the first time I read it.

Sterling captures the epic of sweep of posthuman history, following Abelard Lindsay, diplomat, playwright, scholar, defector, through centuries of adventures across the vast expanse of the solar system. Space-faring humanity has been blown apart by their technology, drifting into the major camps of the cybernetically enhanced Mechanists and the genetically altered Shapers. The two sides engage in constant covert war, pushing at the very limits of what it means to be a cohesive human community, and evolving towards something as far beyond humanity as life is beyond dead matter.

Against this incredibly imaginative cosmological speculation, Sterling tackles very grounded questions. How do much do we love? How much do we hate? Can we be freely redefined, or are some things (ideals, scars, destinies) fixed? How can we measure ambition, power, accomplishment, the value of a life? This book, with the novel and handful of Shaper/Mechanist short stories included, is Sterling's masterpiece-the high voltage work of an author at the top of his game. Read it.

***
Updated for Jan 8, 2017: Still perfect.
Profile Image for Allison Hurd.
Author 4 books944 followers
November 29, 2024
My GR friend Charles accused me of "hating" this book because it's been a couple of months since I read it and I'm only now reviewing it. That is much more a consequence of life bein' life than it is of my sentiments.

I did not hate it. For this type of book to have been published in 1996, I can appreciate its significance and the import it had on the genre. I appreciate it as foundational to the genre. I can see how it shaped the hard social scifi of the next decade. I think it contemplated the paths current day humanity has before it in a prescient and honest way. That said, my money will forever be on Pandora's Star by Hamilton if I have to pick a multi generational epic based on economic differences.

CONTENT WARNING:


Things that were awesome:

-Gene splicing vs. body modification. In the 90s, cloning and genetic modification were a Big Topic. By sequencing a human's full DNA and cloning a sheep, we launched dozens of branches of science and ethics regarding the use of the human genome. It was also a time when we were considering how best to support people with limb differences, mobility issues, and body dysmorphia. As a child who grew up with this in the news, I remember, and I think this book is iconic for its contemplation of all the different outcomes over dozens of years.

-The immediacy of the writing. I always admire authors who can approach epics and maintain the same energy at each stage. You'd think someone would get tired of a character after narrating their activities for a few centuries, but Sterling was dogged.

-The internal consistency: The author made premises and built off of them. I'm not sure what else anyone can expect from SF. It was complex, nuanced, logical, and followed to its natural conclusion.

Things that did not work for me:

-Reaganism in SF. I'm no longer a child. I have seen how certain policies played out in real life and frankly, I'm over it. The 80s died. The 80s fucked me and mine hard. It was great while it lasted, but it did not last, and now in the cold light of late stage capitalism, the shine has worn off.

-Style. Again, Hamilton gets my vote for a book that survives the future. This one was an important stepping stone, but it is not the end all be all, and I'm not sure it's the best of its ilk. Perhaps fortunately, perhaps unfortunately, the generation spanning works in SF before this are fewer, and then about a decade later there were so many they become almost impossible to distinguish, so it gets compared against Foundation and then more pop culture works from my young adulthood.

So, I did like it, and find it extremely relevant to the history of SF, but I'm not sure I'd call it the future of SF either.
Profile Image for Brian Clegg.
Author 162 books3,172 followers
January 20, 2025
Bruce Sterling is one of the key figures from the cyberpunk phase of SF. In a way, that term is misleading - unlike punk music, cyberpunk is an intellectual take on the genre - it just had the kind of spiky edginess we associate with the music. The only Sterling I'd read before was The Difference Engine, his alternate Victorian steampunk collaboration with William Gibson, but the novel Schismatrix, along with a handful of short stories in the same future included in this collection, has a solidly future setting.

In Sterling's strangely sterile future, the interesting societies are all based in space habitats - some circumlunar, others extending to the outer planets. Earth itself is left to a regimented society that has abandoned advancement. There are multiple, splintered societies, though many are either Shapers, who use genetic/biological modifications to produce enhanced humans and Mechanists who take the cyborg route.

The storyline itself is relatively simple - what explodes in complexity is the plethora of cultural groupings and cliques, and the different degrees to which humans are leaving their humanity behind, in some cases to extreme levels that are both repulsive and fascinating. Sterling also brings in a number of alien species - one having a major role to play throughout and another featuring in one of the short stories. These aren't really stories where you get heavily invested with the main characters, but rather with society as a whole.

Occasionally the writing feels a little lazy - a couple of times it's not really clear what's happening in descriptive passages without re-reading them, and there's a major plot jump that seems rushed. But there's no doubt that Sterling throws at us a whole host of concepts, from simple genetic modification to Prigogine's views on system complexity in a dazzling but exciting manner. I might have winced at 'the dome maintained [the temperature] at 40 degrees Kelvin' (there are no degrees on the Kelvin scale), but this is science fiction at its impressive best.

I'm not sure how realistic you can consider Sterling's future to be. The biological modifications his post-humans make can be extremely far out... and the whole idea of space habitats has a flawed feel once you examine the realities of making space liveable. For that matter his future society is depressing: one where cultures seem unable to hold onto any stability for more than tens of years, and often are distinctly superficial. But it's a great ride.
Profile Image for Lorena.
1,084 reviews213 followers
September 5, 2020
The only reason I finished this book is because it was my job and I was being paid to do it. I run a SFF book club for my library, and I try to come up with cogent questions to start the discussion and keep it moving if there are ever any lulls (which happens rarely, in a group of smart and opinionated SFF fans), but these were literally the first two questions I came up with to share with the group:

1. WHAT HAPPENED
2. LITERALLY WHAT IS ANYONE’S DRIVING PHILOSOPHY OR MOTIVATION

I agree wholeheartedly with another review that called this book under-theorized, but with sharp descriptions. The problem is, the descriptions go nowhere. None of the factions and why they are fighting are ever explained in any coherent way, and the main character is a bit of a feckless Gary Stu. It also suffers from that common yet unpleasant trope of its time, wherein the most amazing thing is that the hero manages to accomplish anything at all, what with all the Space Babes throwing themselves at him and demanding he make the sex with them IMMEDIATELY upon meeting him. These women are then usually killed off, to spur the hero on to further righteous accomplishment (maybe...since it's hard to tell what he is doing or why he is doing it the whole time). This, plus the exceedingly dodgy "science" and the extremely Arthur C. Clarke ending, make me question why this is commonly classified as hard/cyberpunk sci-fi, as we are clearly well into fantasy territory here.

The short stories at the end of this edition have much tighter writing and more coherent plotting (except for the very last, which is literally a list of 20 bullet points about a character, and seems more like an outline for another book/story than anything else). All in all, it seems like Sterling should have stuck to the short story format, because the novel hangs together not at all.
Profile Image for Brian .
429 reviews5 followers
July 4, 2019
I enjoyed this! Sterling's writing style hooked me int he first few pages. I appreciate his literary feel, and his use of drama, and non-typical sci-fi aspects in his novel. The story unfolds over the life of the main character. It's a future world hooked into computer systems, genetic manipulations and hybrids, aliens, inter-planetary issues, action, mystery, suspense. Although I found the writing difficult to adapt to, I found this a great pleasure. I like his characters. They have depth to me. He also describes in detail the workings of the technology, which makes it more believable.
Profile Image for Kaila.
927 reviews116 followers
March 20, 2020
I don't normally like cyberpunk and given the choice, I never would have picked this up. But a book club chose it, so I had to read it. And then I actually...liked it? I can't even put my finger on what exactly I liked about it. It was a romp through space without a storyline. The characters did not do anything meaningful or memorable. I just enjoyed myself.

It vaguely reminded me of the Culture series by Iain M. Banks. If you are looking for something to fill the Banks shaped hole in your life, maybe this would be a good thing to pick up.
Profile Image for Jules.
100 reviews27 followers
June 21, 2016
[somewhere at the bottom of a well]
"Steve! Steve, wake up! Come on, Steve, we got work to do. Steve!"
"Senhor, is that you shouting? It's two in the morning. I was sleeping. Who died, where is burning?"
"Nonsense, Steve. It's two in the midnight. Come, we have work to do. We're back in business, I have a review to write and you're staring in it. I'll tell you the plan on the way, come, come."
"Senhor, you're an asshole."
"I know it, the Queen gave me a medal for it, that's why I'm a sir."
[next evening]
A May rabbit rabbit rabbit walks into a bar. The shocked bartender asks:
"My god, what happ-"
"Sim perguntas, Decim. The reviewer deludes himself he's a Shaper artist."
"Oh, come on, Steve. Just play your part. I should have left you on that Jalapeño pirate ship. Decim, come drink with us on the table. I've just read this book, Schismatrix Plus, got some notes from it and I want us to discuss it so I can make a review."
"I had read it too, a long time ago, don't remember much from it, save for the cockroach tequilas I still make from time to time."
"I'll have one of those, if I may. Senhor is paying."
"Alright, the general impression: this book is a basket full of goodies the writer took a piss on then ejected into space."
"Isn't this a bit harsh? I know it has an experimental structure, but it was meant as a cyberpunk experiment."
"This is no excuse for the characters he came up with. It felt like I was in a shady oriental open bazaar. Weird characters and entities popping up everywhere begging for your attention, promising you services you didn't even knew existed, behaving strangely (one was walking on his nose hairs instead of his feet) for in the end you discover you got pickpocketed, your trousers are on, but your underpants are gone."
"I never was a fan of cyberpunk, it feels so artificial. Fantasy feels real, I accept talking dragons, but ordinary people being familiar with basic principles of physics and chemistry? That's fake all day. They rather gargle water a beardy mad guy blessed to cure cancer, than actually seek medical care."
"Scientists say all particles vibrate. Does this mean vibrators are particle accelerators?"
"That's not how it works. The closest particle accelerator you're going to use is your microwave oven. You can make popcorn and fly in space with sublight speed in less than 2.5 minutes. I told you that crate of second-hand sex toys was a bad investment. Read this book, genetically engineered prostitutes are the future."
"Speaking of popcorn, I find it interesting how in these cyberpunk novels the human race is augmenting itself with drugs, hormones, prosthetics, jumps from one fashion to another, from an extreme to another, they are restless, eager to accede another state of mind, yet politically they behave the same for thousands of years."
"Maybe it's politics that defines humanity. Bad politics that is."
" The book itself it's lacking a direction, a certain plan, a fluent story, some characters to love and others to hate. I wish the main character wasn't so over sexualized, or maybe this is due to the drugs."
"What drugs, the ones mentioned as aphrodisiacs are good only to dye your eggs."
"Steve, don't dye your Easter eggs with aphrodisiacs, please. You also have vasopressin which is %$*@& and *@&_)#(. At some point I found
TCGAGGCTATCGTAGCTAAAGCTCTCCCGATCGATATCGTCTCGAGATCGATCGATGC-TTAGCTAGCTAGTTGTCGA TCGTAGGGCTCGAGCTA
And I was really excited to decode it hoping there was a secret message hidden in it. There isn't, but then it is too short to even mean something else than a string."
"So is your life."
"Decim, I thought you got rid of that annoying talking goat."
"It isn't a goat, it's an alien that calls himself the Swarm."
"Makes perfect sense. Then I'm left with all these ideas that floats into a void which is the story, ideas that revolves around the fact that we are a primitive society and will always be because it's in our design and the fact that the threat of death is bigger for the happy ones."
"Let's not forget about the obsession with bacteria, mold and microorganisms."
"Speaking about molds, I'd have another beer. And a cockroach tequila for Steve. In the end I just hope this book will serve as inspiration for writers such as Al Reynolds and expect nothing more from it in terms of a story. About the ideas I've noted, we'll talk when you get back with the drinks."
Profile Image for Peter.
704 reviews27 followers
December 30, 2017
Humanity has moved out into the solar system... and schismed, with different factions employing different philosophies to endure and thrive in the harsh environment. The Shapers rely on genetically engineering themselves. Mechanists rely on cybernetic enhancement. They aren't the only factions out there, just the biggest, in the ongoing quest to determine humanity's destiny. Abelard Lindsay is an assassin, a diplomat, a con artist, a political exile, an entrepeneur, and someone who finds himself in plenty of crazy situations in his long life.

This book collects not only the novel Schismatrix, but also all five stories in the Shaper/Mechanist universe. I had only read one story in that universe, "Swarm," which I liked enough to instantly want the whole universe to read in one handy book.

Unfortunately, that presented bit of a disappointment problem, because, at least to my tastes, "Swarm" is far and away the best story in the book, and everything else really isn't even all that similar in style.

I still enjoyed the book, mind you, it's got enough of the cool ideas, eyeball-kicks full of wild concepts and environments and people that I love from science fiction, and you can see where other authors I've enjoyed got influenced by this book, which is enjoyable on a more fandom level. But it just didn't live up to what I was hoping it'd be.

One problem is that the novel jumps around an awful lot, most sections of the book are years or decades past a previous section and deal with whole new events, making the novel feel a bit like a series of short stories itself (leaving aside the actual short stories included at the end). Sure, they focus on the same cast but there wasn't a whole lot to hold on to. This reminded me of Charles Stross' much later book Accelerando, but it didn't work nearly as well for me, the characters weren't quite as relateable to start with, never mind what they turned into.

There were certainly moments of intense interest (particularly when the alien Investors started coming into the story, but that highlighted one of the disappointments, I was hoping more of the alien angle would work into things), but it was also, occasionally, a slog. And by the end of the book, I think I have officially gotten thoroughly and completely sick of the phrase "Prigoginic Levels of Complexity," a phrase I'm not sure I'd heard before it but now am pretty sure I never want to see again... not from the idea itself, but just from the overuse of the buzzword. That's not a good thing from a SF book which usually leaves me excited with the new ideas or terms it exposes me to. How it related to the ending of the novel also made it fall flat for me, it's just not the kind of SF conceit I'm that into, unless done very well.

It wasn't really a huge issue for me, because I'd been exposed to details about the factions long before I read the book, but I also feel the novel was lacking a decent 'mission statement' for who the different groups were and how they operated that might have helped people who went into this cold. I feel like reading it like that you'd just be thrown in with names of groups and told they were conflicting major powers without really knowing what philosophy binds them or how they developed (and I was also hoping to see more of that info myself).

If I just read the novel, I'd probably rank it as a high two star book, while acknowledging how important it was. With the short stories included, it brings it up somewhere in the low-mid three star range, though mostly for "Swarm" rather than the others (which to be fair, had their moments too).
52 reviews58 followers
January 22, 2015
SCHISMATRIX PLUS is one of Bruce Sterling's early novels, long unavailable, and now back in print as an ebook. (The "Plus" indicates that the book also includes a bunch of short stories set in the same future world as the novel itself). This novel has much more of a far-future setting than the bulk of Sterling's subsequent work. It follows the adventures of the main character, Abelard Lindsay (though at times he uses many other names) from being a 20-something rebel to being the 200 years old or so (due to life extension technologies) guru of his own particular faction of posthumans. The novel explores the posthuman condition -- or better, a multitude of posthuman conditions, as advancing technology leads human beings into many different possible reconfigurations, many of which do not sit well with one another. In the course of the book, there is a kind of speciation of multiple, and incompatible, posthuman variants. The main social development in the solar system of the novel -- filled with inhabited moons, planetoids, asteroids, and artificial habitats -- is the split between Shapers (who retool the human genome for increased healthy, intelligence, and agility) and Mechanists (who retool their bodies with all sorts of mechanical and computational augmentations). But in the course of the book, this basic duality or antagonism seems less and less important, as multiple new forms of posthumanity get constructed. By the end of the novel, we are looking at radical genetic reconstruction to allow posthumans to live, breathe, eat, and reproduce in the oceans beneath the crust of Europa (the Jovian moon). What gives the book its power and tension is the harsh conflict between a sense of wonder at the majestic technological reinventions of humanity on the one hand, and a depressing view of ugly power politics which seem to be replayed endlessly regardless of technological means. At one point, the narrator notes, of the expansion of human beings into other parts of the solar system: "It was a complex and depressing history, littered with betrayals, small-scale rivalries, and pointless power games." In Sterling's vision, however much we change ourselves, we never really get away from this sort of recurring and stupid conflict. But Sterling also suggests that it may well be this sort of "depressing history" that spurs potentially liberatory inventions. Throughout the novel, Abelard Lindsay is never contented. He is perpetually restless, or even perpetually in a rage, over the limitations of society and indeed of embodied experience. And so he continually moves from one sort of technological and social living arrangement to another -- the continual process of discovery and innovation itself seems to be the point for him, rather than its necessarily limited results. I am inclined to think that this is all too accurate a portrayal of how desire and innovation work under capitalism -- though the aesthete in me insists that another world is possible. Sterling doesn't himself envision such another world, but his novel convincingly shows that no degree of technological self-transformation can in and of itself change the gloomy parameters of this one.
181 reviews6 followers
March 29, 2016
The huge issue with this book is the fact that the story is told as if the reader is present and infinitely familiar with the social, political, and technological developments in the Shapers/Mechanists universe. Sterling occasionally has a a moment where another character talks about what's going on on the various planets (like when Ryumin or Greta Beatty gives him a quick tour of their world), and those parts read smoother than the rest of the novel. In sci-fi and fantasy, world-building is incredibly important; the author can't assume we understand his/her world like he/she does. Especially when the main character is basically a con-man of sorts for most of the novel.

The second major issue was characterization. I didn't understand why Lindsay and Constantine were fighting over Vera in the first place. How did they get together? Why was Vera so fascinating to both men? There were a bunch of words talking about Lindsay's stint at Shaper Summer Camp for Diplomatic Leaders (TM) but no exposition as to why they "rebelled" or what they "rebelled" against. Okay, I do concede one thing--Lindsay was quite a condescending bougie asshole when they were younger. I'd have tried to kill him too.

I was quite irritated with the Geisha Bank as a concept. It seemed exoticizing and weird--why is it that Japan (and now Korea, I guess) are always the only Asian countries with any influence in future worlds? Looking population size and their long lasting histories, it'd be India or China that would exert the major influence of the area. I also hate it when Western writers use Geisha as concepts because they always end up as whores, which isn't really how they're seen in Japanese society.

The short stories, on the whole, did a better job of world-building and exposition than Schismatrix itself. The extra star goes for those. In fact, Swarm is probably the single gem in the entire book, worth a good 4-5 stars on its own, but because the majority of the book is terrible, I almost didn't even get to that part.
Profile Image for Chloe.
374 reviews809 followers
August 4, 2008
This was the science fiction odyssey that I've been longing to read all summer. I'm glad that I finally found one that captivated me from start to finish as I was starting to think I might be burnt out on the genre- a frightening thought.

Sterling's book collects a number of stories all set within his Shaper-Mechanist universe, with his first novel Schismatrix forming the backbone of the story. Following humankind's ascent into the stars, Sterling creates two competing directions for our evolutionary path. The first is that of the Shapers, a segment of humanity using genetic modifications to make themselves smarter, faster and more capable of facing the challenges of space. Opposed to the Shapers are the Mechanists who, as their name implies, are relying upon machines to lengthen their lives and repair the frail human form.

More than just blandly stating his take on the important "where is humanity going?" question inherent in most good scifi, this stands out as a series with fleshed out and realistic characters. The only other book that I can think of where he accomplished this is the fantastic Distraction.

I have to admit that this is one of very few Sterling novels that I've enjoyed with no hesitation. It had everything cyberpunk is supposed to have and I can finally see why he is viewed as a godfather of this genre. At his best, as he is here, he is a visionary writer who crafts worlds that feel feasible as though he is looking down a quantum portal at the possibilities of humankind. I have another collection of his works here and I'm sorely tempted to keep the Sterling binge going.

Profile Image for Ryan.
137 reviews27 followers
October 17, 2012
I picked up this book based solely on Alastair Reynolds insane props:

"I owe an equally obvious debt to Bruce Sterling, whose 'Shaper/Mechanist' sequence blew my mind on several levels. Sterling's future history, even though it consists of only a single novel and a handful of stories, still feels utterly plausible to me twenty years after I first encountered it. Part of me wishes Sterling would write more 'Shaper/Mechanist' stories; another part of me admires him precisely for not doing so. Read Schismatrix if you haven't already done so: it will melt your face."

That is exactly what it did too, melt my face. I still remember when I finished it, I honestly sat there for 30 minutes utterly stunned by what I had just read. This isn't typical cyberpunk either, but it was written a year after Nueromancer and was also one of the books that has heavily influenced and defined what cyberpunk has become. Schismatrix Plus is everything ever written about the 'Shaper/Mechanist' Universe. It includes every short story as well as the full length novel Schismatrix, what's more is that it is all arranged in the way the Sterling intended it to be read. It is difficult, abstract, and intense beyond anything I could have imagined, but when you finish, you will utterly agree with Reynolds description.

More reviews and recommendations at http://ryetopia.blogspot.com
Profile Image for Vít.
785 reviews56 followers
September 22, 2018
Skvělá věc, jak román, tak zejména povídky ze světa Schismatrixu. Je to vlastně příběh o konci lidstva, o jeho přeměnách, o mnoha cestách, kterými se vydává. Zažijete časy válečné i mírové, revoluce jak politické, tak technologické, mezihvězdné cesty, kontakty s mimozemšťany, smrt i nesmrtelnost...
Moc se mi to líbilo.
Dvě věci mě mrzí: je velká škoda, že toho ze světa Schismatrixu pan Sterling nenapsal víc a také to, že jsem tuhle knížku neotevřel dřív.
Profile Image for Smiley III.
Author 26 books67 followers
May 19, 2018
Essential reading. Fucking unbelievable.

Even more useful in the Age of Trump, considering the adjustments you have to do every day. The parallels are that far afield, and little else will thusly stretch your mind.

You'll be better off.

(Buy it, and share with friends! This is banding together; this is sharing resources.)

















Profile Image for Jason.
94 reviews50 followers
April 4, 2015
This is a most difficult read. If you're considering reading this book, be forewarned - information overload is the name of the game. This is not confusing in a modernist stream-of-consciousnessness Joycean sort of way; it's just confusing in that the information and exposition are delivered so quickly, in so few words, you may have to reread several paragraphs numerous times before the facts finally "click."

But when they do, and you suddenly understand, your brain will glow with new knowledge, your eyes will widen, your heartbeat will quicken, and you will be pulled along rapturously into one seriously bizarre and unforgettable epic. This is science fiction of the most ambitious and wide-ranging kind, with constructions of future humanity taken as far as imagination could take them without crossing the line into all-out fantasy. It has politics, psychology, drama, tragedy, backstabbing, adventure, economics, space travel, science, science gone haywire, a plot as complex and gripping as all hell, and characters as strange as they are believable. Sometimes, the stranger they get, the more believable they get.

Again, this is hard stuff. It needs to be read slowly, in chunks, and those chunks often reread slowly. But the investment is absolutely worth it. This is a towering narrative of the future, a marvellous romance in the old definition of the term, and a very strange ride. Enjoy.
Profile Image for Rob.
Author 2 books442 followers
December 27, 2009
SHORT VERSION: (not a real review)

• 1st: "Swarm" — reeeeeally liked; I can see why it's so popular and well known — reminds me of Blindsight — except that Blindsight was probably in-part inspired by this...?
• 2nd: "Spider Rose" — reminds me of that PKD story "Beyond Lies the Wub"
• aspects of the main novel (Schismatrix) cued in my mind visions of: "this is Neuromancer on extraversion" (but mostly I think that b/c they're contemporaries?); also cued: "smatterings of this show up in Accelerando " (but maybe they're just sharing tropes and/or formats? arcs?)
• I think I need a re-read to unpack it and put it all back together


--
A note about this edition: it's an omnibus—and as such it contains Sterling's novel (Schismatrix) plus all the short stories in the Shaper/Mechanist milieu.
Profile Image for Florin Constantinescu.
552 reviews26 followers
July 23, 2017
This is one of the worst written 'famous' novels I have ever read. (Allow me to call it a novel, although this is actually an omnibus - containing some short fiction from the same universe alongside the novel).

I had trouble completing phrases, let alone paragraphs, or following characters. Feels like reading a Chinese translation re-translated to English. Wish I could comment on the plot - but I was unable to discern it. Stopped about 100-150 pages in.
Profile Image for C.S..
18 reviews
October 5, 2007
The cyberpunk movement is one I will never be able to get into. It is creative, but one of the characteristics of this book is that the author writes as if the story is happening in our present world, so he does not define words and key elements just as an author writing in the present wouldn't define terms they assume are collective knowledge. It bored me.
Profile Image for Gwern.
263 reviews2,957 followers
June 20, 2013
Quite remarkable. One of the best solar system colonization universes with a baroque and cyberpunk-inflected computer/biology split.
Profile Image for Elar.
1,426 reviews21 followers
May 12, 2023
Reminded me a little bit Bank's Culture series, but not as grandiose and not as captivating.
Displaying 1 - 30 of 274 reviews

Can't find what you're looking for?

Get help and learn more about the design.