Jump to ratings and reviews
Rate this book

This Mortal Coil #1

This Mortal Coil

Rate this book
“Redefines ‘unputdownable.’” —Amie Kaufman, New York Times bestselling author of Iluminae
“I was thrilled. I was shocked.” —NPR
“Stunning twists and turns.” — BCCB (starred review)

In this gripping debut novel, seventeen-year-old Cat must use her gene-hacking skills to decode her late father’s message concealing a vaccine to a horrifying plague.

Catarina Agatta is a hacker. She can cripple mainframes and crash through firewalls, but that’s not what makes her special. In Cat’s world, people are implanted with technology to recode their DNA, allowing them to change their bodies in any way they want. And Cat happens to be a gene-hacking genius.

That’s no surprise, since Cat’s father is Dr. Lachlan Agatta, a legendary geneticist who may be the last hope for defeating a plague that has brought humanity to the brink of extinction. But during the outbreak, Lachlan was kidnapped by a shadowy organization called Cartaxus, leaving Cat to survive the last two years on her own.

When a Cartaxus soldier, Cole, arrives with news that her father has been killed, Cat’s instincts tell her it’s just another Cartaxus lie. But Cole also brings a before Lachlan died, he managed to create a vaccine, and Cole needs Cat’s help to release it and save the human race.

Now Cat must decide who she can The soldier with secrets of his own? The father who made her promise to hide from Cartaxus at all costs? In a world where nature itself can be rewritten, how much can she even trust herself?

448 pages, Paperback

First published November 7, 2017

Loading...
Loading...

About the author

Emily Suvada

7 books872 followers
Emily Suvada was born and raised in Australia, where she went on to study mathematics and astrophysics. She previously worked as a data scientist, and still spends hours writing algorithms to perform tasks which would only take minutes to complete on her own. When not writing, she can be found hiking, cycling, and conducting chemistry experiments in her kitchen. She currently lives in Portland, OR, with her family.

Ratings & Reviews

What do you think?
Rate this book

Friends & Following

Create a free account to discover what your friends think of this book!

Community Reviews

5 stars
4,679 (39%)
4 stars
4,517 (38%)
3 stars
2,026 (17%)
2 stars
476 (4%)
1 star
127 (1%)
Displaying 1 - 30 of 2,168 reviews
Profile Image for Paromjit.
3,080 reviews26.5k followers
March 23, 2018
Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against the monolithic Cartaxus Corporation. She is the daughter of the most able scientist in the country, Dr Lachlan Agatta, working on a solution to the plague. He and his assistant, Dax, were forcibly taken by Cartaxus,, to work for them two years ago. Before he was taken, he drummed it into Catarina that she must never trust or have anything to do with Cartaxus. However, a Cartaxus soldier, Lieutenant Cole Franklin, now seeks her out, under the radar, to inform her of the death of Lachlan, and that he succeeded in developing a vaccine. Cole is implanted with the latest technology, including the vaccine, but the coding is beyond them, the only way they can save the world is by working together and making their way to a Canadian Laboratory.

Suvada creates an intricate and complex post-apocalyptic world where people can be implanted with technology to recode their DNA, to potentially become whatever they want to be. Healing Apps are in everyday use, and the scientific explanations, given in some detail, are clear and easily understandable. Cat is not certain she can trust Cole, but it soon becomes clear that her father has coded him so that he will protect Cat as his most overriding mission. As Cat and Cole endeavour to reach the Canadian Lab, they face betrayal from every corner and nothing is as it seems. Cat is astonished to discover that a Cartaxus bunker is nothing like what she expected it to be. Cat's journey leads her to discover that there is much more to her than she was ever aware of. This leads to momentous world shifts as Cat is forced to rearrange her realities. In the meantime, Cat and Cole's relationship assumes a chemistry and importance that neither see coming.

This is an atmospheric and gripping story that you cannot stop reading until you reach the climactic end. There is clearly more to come in this story as the issues are not resolved. Suvada has taken established science fiction tropes and given them an original spin in this novel. The narrative is imaginative, has considerable depth, and the story is impressively plotted. The characters grab your interest, are well developed, and nuanced. Cat is tough, vulnerable and courageous, willing to put the interests of the world above her own. I have no doubt that this is a book that is going to do well, and quite frankly it deserves to do so. A fantastic and absorbing read that I highly recommend. Many thanks to Penguin for an ARC.
Profile Image for Elle (ellexamines on TT & Substack).
1,189 reviews19.3k followers
March 8, 2019
2 1/2 stars. This was… interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn’t love it.

The obvious upside of this book is that it is just... really wild. The broad concept of worldbuilding is sort of terrifying — I mean, a disease that causes people to explode and leads those in the vicinity to try and eat them? Holy shit. Suvada is truly not afraid to get into the gore of the premise, meaning things get kind of hardcore — someone gets their ear bitten off? There are so many twists and reveals that I’m sure you’ll be surprised somewhere, including a twist in act three that I… okay, I did see it coming, but I liked it anyway.

The big problem here is that I just found this one very hard to connect with . You all know what a slut I am for character-driven stories, and while I actually liked the protagonist of this story, I never connected with her. I will fully admit that she is kind of a badass and this only makes it more sad that I didn’t connect with her.

I was also disappointed by the focus on the unnecessary love triangle. One of the love interests is just not even a bit necessary. I do not exaggerate, this book would barely even change if he weren’t a love interest. The other is just kind of bland. Like… he’s fine, I don’t hate him, but his characterization is nonexistent. He goes from Bad Boy to Soft Boy by the second as if he’s trying to hit every YA trope at once, and overall just reads bland.

So overall, this was interesting, but I don’t think I’ll be continuing. Something plot-driven and well-paced like this would’ve been enough for a standalone. But I can’t see myself obsessing over this, and that’s what I need from a series.

Blog | Goodreads | Twitter | Youtube
Profile Image for L A i N E Y.
408 reviews830 followers
July 9, 2018
“There’s no such thing quite as dangerous as an Agatta’s best intentions.”

The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn’t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I was all ‘Whoa, don’t do this to me girl, this is not cool’ But too late! It took hold and from then on her mantra was ‘everything is my fault’... How tiresome. But nope!, the book isn’t finish yet because then that ‘twist’ happened.... I don’t know why we needed it since it’s already a good book why adding it at all? It was interesting before. Now it sort of turned somewhat ‘soap opera-ish’ for me....

I filed that under the ‘unnecessary twist’ pile.


The best part of this story are:

1.) the Hydra virus and how its infection and immunization work: gruesome and really unique.

2.) The carefully thought out genetically-enhanced world they lived in even before the virus attacked. Such freedom, almost to the point of absurdity. You could grow a tail if you heart so desired? Grow fur in the winter that you can shed when summer comes round? An app called ‘skinSmooth and luster’? Now that is something I could use!

One thing that really makes me think is everyone has ‘healing tech’ built-in and how doctors actually can barely heal you traditionally anymore because they’re so used to just fine-tuning your apps than ‘treating’ you physically. How scary to think that we all get so used to technology and how much we end up depend on it to the point of in danger of losing our learned skills. Such a terrifying thought indeed.


I’m no sci-fi connoisseur but even I enjoyed everything about this genetics-science-talks in this book. How instinct is ingrained and how the brain works. There’s something to be said about how ‘realistic’ the world is since evolution still works the same way and keep biting human beings in their ambitious ass.


“There’s no such thing as right anymore - that ended when the plaque hit. Sometimes we need to do awful things to stop worse things from happening... this is war, and the rules have changes”


Profile Image for Alice.
229 reviews50 followers
February 11, 2018
3.5* A world where a disease has taken over and people have tech installed in their bodies.

It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books that are MORE entertaining / action packed so I don't really recommend this. I ultimately like this book now that I actually read the whole thing, but it sure is stupid. If you read this book you're probably like woah no way, how is this stupid the world is so intricate and blah blah blah. Yeah the world is intricate, but everything about the structure, plot, and characters are horrible.

The world is intricate yes, but the way the world is woven into the story is mainly through the characters telling the reader. The characters will just start explaining what they know about the world they live in for a few paragraphs whenever a scene arrives that needs the explanation. So many details about the tech and genes are revealed this way. Tons of paragraphs of explanation.

So many details of the plot are revealed in the exact same way as the world. Along with that so many plot points were because of stupid actions by the characters. Convenient scenes were just thrown in there at the right moment.

THE CHARACTERS. Even if you are fine with everything else I wrote above, HOW COULD YOU DEFEND THE HORRIBLE CHARACTERS. The cheesy ass villain. The no chemistry romance. The annoying ass characters. The kinda, but not really love triangle.

I HAVE THINGS TO SAY ABOUT THE ROMANCE. Catarina and the love interest Cole literally only like each other because they are VERY sexually attracted to each other. Romance is a huge part of this book. Their romance makes no sense because there's nothing in the story that shows that they like each other BESIDES him wanting to protect and care for her. Which Cole is programmed to do by the way. Also they just really want to fuck each other if I didn't make that clear enough.
Profile Image for nemo ☠️ .
974 reviews503 followers
September 5, 2017
((2.5 stars, rounded up for THAT plot twist))

hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while.

i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shortage of apocalyptic plagues in speculative fiction, but both the concept of the virus itself and the circumstances surrounding it were extremely original. i mean, bodies exploding and floating around in a giant Death Cloud??? that's the kind of macabre shit i can really get behind, man. there were also so many plot twists, and i wasn't expecting at least half of them.

but then...

there was so much potential, but it was just watered down by the writing and the characters. i mean, it should have tipped me off when the book opened with Unnecessary Bird Death (i love birds so if you kill them that's a huge fuckin black mark, my friend) and then the annoyances just multiplied from there.

first off, THERE IS A LOVE TRIANGLE. yeah, i know. this is like, a mortal sin in YA literature in the year of our Lord 2017 and it ticks me off that the editor didn't go, "hey, you know, you don't need this #Drama with the old love interest, you can just have the new one. or, maybe, none at all, maybe just a strong platonic love because romantic love is not the be-all and end-all of human relationships"

but romance is kind of, not my thing. i don't mind m/m and f/f relationships, simply because i'm a Huge Queer and i love seeing people like me in books, and that feeling of "YAS QUEERS" usually overrides my "ew romance" instinct. unfortunately, this was neither a gay relationship nor a particularly exciting and nuanced romantic relationship that i could get behind. because hey, i'm not like, anti-straight people, i like lots of m/f relationships, it's just my Bullshit Tolerance Level is always lower.

and this, my friends.... was a lot of bullshit.

i just don't see the point in having a romantic relationship when a platonic relationship would do just fine. and why the HELL do boys smell so nice in YA books. sweat doesn't smell nice, it smells like gorillas, mkay?

it was kind-of instalove-y. not quite, but it was nearly there tbh. i didn't feel a lot of chemistry between them, and the characters themselves just seemed pretty flat to me. like i said in one of my updates, cat did not seem particularly genius-like most of the time, but rather naive, and cole was like a lovesick, less-cool version of bucky barnes. and dax, the Old Love Interest who reappears, was POINTLESS. i mean come on, why??? WHY???

the writing was also lacklustre. first-person present isn't my favourite tense and perspective, and i think it's becoming a bit overused. i suppose it worked to some extent, as that POV is best for an action/suspense filled narrative and there was quite a lot of that going on, but it seemed too simplistic at times, despite the massive Plot Twist Bombshells that were being dropped left right and centre towards the end.

overall: this was an excellent concept, but was ruined by a messy execution and pointless romance. this has a pretty high rating overall though, so if you like romance in your books you'll probably like this a lot. but if you don't, be warned.


------------------

pre review:

idk if this is going to be good but the title is a reference to both shakespeare and a gothic rock band, and it contains a plague a.k.a. my fave sci-fi/fantasy/etc. trope, so hell yea i'm fuckin reading this
Profile Image for emi.
666 reviews1,150 followers
probably-never-read-tbr
July 5, 2017
Who is this cover and where can I marry it????
Profile Image for Abbie (boneseasonofglass).
333 reviews413 followers
December 13, 2017
This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down

Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y

you can tell the author researched it all and knew what she was talking about

i'd definitely recommend if you enjoy ya sci-fi
Profile Image for Trina.
934 reviews3,855 followers
June 22, 2018
A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead.

At times I thought this was just plain weird, and it is, but I enjoyed it.

Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self injury - not disordered self harm, but like needing to cut something out of a wound for survival.

Audiobook: The narrator slightly mispronounced several words, but upon some searching I discovered that she's British and using British English pronunciations, so she wasn't incorrect. The book is set in the US with US characters and she uses a US accent, which is the only reason those words stood out to me.

She did get really into her performance, but that involved quite a bit of yelling during action scenes. Beyond just the yelling, the audio seemed to vary in volume every once in a while. Between these two things, I was constantly needing to adjust my volume to find a comfortable setting.

Those things didn't take away from the story to me, but they are worth pointing out if they would bother you.
Profile Image for Jill.
798 reviews792 followers
October 29, 2017
I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE

Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I’m not really sure why it just did xD it’s like a sci-fi tech version of The Darkest Minds.

I just had a few problems with the characters and the plot was a bitttt slow at some points. But, overall, it certainly kept me reading and entertained!
Profile Image for Dannii Elle.
2,401 reviews1,854 followers
September 4, 2017
Actual rating 4.5 stars.

I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a lone few are left to somehow save the world. That is exactly what this novel does. But where as many of the other titles I have read perform to their stereotypes and deviate little from this generic outline, this managed to deliver something different.

Whilst I have read the basic premise for this novel before, Suvada managed to make it appear fresh. And she does that by making it feel believable. The scientific whys and hows to this novel are explored from every angle. Instead of just allowing an unexplained and unknowable phenomenon to befall us, an understandable and functioning explanation is provided. The reader is given an authentic-feeling insight into computer coding, DNA sequencing, and gene mutating. Now I know little about any of these things so maybe someone with a background in these topics would be able to call bullshit, but to the uninitiated this felt like a very real exploration of the potential future of our species.

In addition to this authenticity were the characters, I initially feared the dreaded insta-love trope was once again going to rear its ugly head, but this, fortunately, managed to remain trope free! Each of the characters felt like well-rounded and real individuals and so I believed in each of the chaotic episodes they found themselves in.

Whilst I enjoyed every portion of this novel, the ending was its phenomenal crowning glory. Twist after twist mutated the plot until it was unrecognisable from its original conception and transformed into something truly unforgettable. If I wasn't sold by the rest of it, this ending would keep me reading an eternity's worth of instalments in this series. So with that said, when is the next one due?

I received a copy of this book in exchange for an honest review. Thank you to the author, Emily Suvada, and the publisher, Penguin, for this opportunity.
Profile Image for patrycja ୨୧ ‧₊˚ .
185 reviews266 followers
August 8, 2025
— 3.5 ★
⊹ "when you love someone for their mind, you can't expect that their heart will belong to you too." ៹࣪
fast-paced. coding. technology. dna sequencing. gene mutating. good plot twists!

⭑𓂃 ⌗ my thoughts

it was such a great dystopian book—it's been a while since I read one! and I sorta missed that genre—it slaps while done well :) I absolutely loved the word building—it was so well thought-out & simply brilliant. I was lowkey dying in my bed after getting my final vaccine, but this book managed to deliver so much fun, and I actually had a blast. the story was so gripping & compelling. I got totally hooked, and I just couldn't put it down, because I wanted to find out how everything would be played out. the plot twists were so good, hands down 🙂‍↕️ also, cole & catarina deserve their special mention! they were so cute, and I can't wait to see more of their relationship in the next books 🧸

⭑𓂃 ⌗ quotes

"it's funny, that saying—I'd rather die. It's funny because nobody means it. the truth is that when you're facing death, there’s no telling what you'll do."

"maybe it's what we've been through, or maybe we really are broken in the same way, our jagged edges aligning perfectly."

"there's no such thing quite as dangerous as an agatta's best intentions."

"most of human behavior and its relationship to dna is still undiscovered territory. we know what genes make rats afraid of eagles, and we know why birds fly south in the winter, but the complexities of human nature are still a mystery to science."
Profile Image for Emily Suvada.
Author 7 books872 followers
Read
June 12, 2018
TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTCATTTCTAATTTGGTCATTACCCACTATGGCAGTAAGCCAAAAATCGCACATTGTCGCGATCTGGGCTCGTTGACTGGTGCTCTGCTGTAGTGGTGCATTGGGGTACACGGTAGCAGCGTCTCACGGAGCATGCTATTCTCGTAGATTCCTAAAGTTGACGCTTCCAATGCTCCTCGGGTGCAGGAGATCAGCCCTGCCATGCTGGTAGAGAGCATAGGACGCTAGAAGGTTCTGAGGCAGTTTTGTTTAATGCAACCATCCTCGCCTGCGAACAAACTTATTTGGATATCTACATAATTCCTTGTTTGGTTGACACCTCCTAAGGTAGACAGGGTGATACCATGTGTCCAAGTTTAGAATAAAGGGTACGTCGTATCGAGCAAGAGTGGACGGAACGAAGAGATCAATAGAACATAAAACGCCTTAACGAGCGCAGCGCATA
Profile Image for Claude's Bookzone.
1,553 reviews274 followers
March 19, 2021
UPDATE 17/03/2021 - Review added
CW:

Well that was a complex rollercoaster ride with hi-tech science, genetic coding, and a gory deadly virus.

How fabulous to see women in science featured so spectacularly in this YA novel. The world was so detailed and the characters engaging. The story line had so many elements to it but I never felt overwhelmed. There was a degree of instalove but it was't overly offensive. I thoroughly enjoyed this and recommend it for any young adults who are STEM subject inclined or anyone who a loves good science fiction thrillers.


UPDATE 16/03/2021 - Rereading for booktalk about genetic engineering in fiction.
339 reviews661 followers
November 8, 2017
this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that’s all for now)
Profile Image for Sara.
1,565 reviews436 followers
November 5, 2017
I received a copy of this book in exchange for an honest review.

3.5 stars.

If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and drove the rest underground, two years ago. But there's more to Cole than meets the eye - genetically enhanced to protect, he arrives to guide Catarina towards the cure they've all been searching for, and she's the key.

The writing for this was wonderfully descriptive, and the overall plot and pacing was good. I never felt bored, or feel the need to skip text to get into the action - the action was pretty much continuous, and I didn't want to stop reading.The world building is also done well, and fully explores the world in which the characters inhabit. However a downside to this was that I wanted to send more time with Catarina on her own in the world, especially when we first meet her. More time spent exploring the horrors that the people left behind must face, and the sacrifices they make, would have helped to better understand the virus itself, and why everyone is so afraid of it. I feel I could have understood the former Neurosurgeon and his family more, and perhaps had more sympathy for them, if I had a better understand of what they'd been through. As it was, I just really wanted Catarina to punish them, and I felt a little let down by her actions.

Aside from this, I liked Catarina as a main character. She's intelligent yet insecure about her abilities, brave yet still reckless and foolhardy. I would have liked to have seen her portrayed in the eyes of the other main characters as someone who can look after themselves though. Too often I've seen these YA protagonists portrayed as fragile young women who need protecting. I want more badass female characters who don't need wrapping up in cotton wool. However, that said I did enjoy her early interactions with Cole, and the playful too-ing and fro-ing of their relationship with some obvious chemistry. This later evolved into something a little forced in my opinion, and it lost the early charm that the author had managed to develop as soon as their feelings progressed.

I would have liked to have seen more interaction with Agnes, her friend first introduced early on. She's quickly dropped as soon as Cole arrives, and barely mentioned again aside from a few offhand comments about her comms link. It felt a bit like she had served her purpose to the early plot, and was quickly left without any further thought until near the end.

However, I did like the moral ambiguity that we see with all the characters throughout the novel, especially with Catarina's father Lachlan. Often the characters are put into morally questionable situations and must decide what course to take. Questions such as: to save millions, is it ok to let a few suffer? What would you do to survive?

The most unique aspect of this book was the inclusion of DNA and technology as the driving factor behind the virus, and humanities growing reliance on it to maintain all aspects of their life. Genetically modified food which tastes like nothing unless an app is downloaded. Apps that allow a person to alter their sight, make them fast, strong. Although sometimes the jargon got in the way of the story at times, I appreciated it for the unique quality it brought to the text.

The ending left me feeling a little bit left down. Not giving anything away, I had very mixed feelings with regards to how the novel developed and I felt I invested a lot of my time in a character that ultimately turned into something else entirely. I thought it was a little bit like taking the easy way out.

That said, this is still a decent science fiction YA novel, and I'd read the sequel.
Profile Image for ambsreads.
818 reviews1,586 followers
November 14, 2017
THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG

Thank you Penguin Australia for sending me a review copy. All thoughts are my own.

R A M B L E

I went into this book with some low expectations. I’m not exactly sure why. I had requested it from Penguin a few months prior and had been really excited, but by the time I received it I was a little apprehensive. I’m not sure if it was just because I wasn’t in the mood for a dystopian or what but I decided to pack it when I was visiting my friend, partially because I wanted to read it and so did she (she later bought the book anyway).

This Mortal Coil is good. Like, amazingly good. I truly didn’t know what I expected but it wasn’t this. The fact this book is a debut shocks me as well. It reads like an author who has been writing for years. Truly. There were some cliché lines throughout, but honestly those lines don’t bother me like they bother so many in the book community. I believe the ‘I let out a breathe I didn’t know I was holding’ line is used but, guys, I’ve actually let out a breathe I didn’t know I was holding so I don’t give two shits about that line in the slightest.

The only reason I didn’t give This Mortal Coil a full five stars is purely for the weird romance featured throughout. I’m incredibly picky with my romances in books though, and most of the time I don’t enjoy them as much as my friends. Also, I had a bit of confusion with all the scientist lingo and coding language. This could have been something I missed while reading and left me confused later on, but I nonetheless I enjoyed this book immensely.

Furthermore, the author of this book is Australian. I love supporting fellow Aussies in the publishing world since I feel I don’t do it enough. So, when I found out Emily Suvada was a fellow girl from Aus I was pretty stoked.

P L O T

This Mortal Coil is a complex dystopian that focuses on the me vs. you that so many of us have. In this world, there is no cure for a virus besides eating the flesh of the infected. Resources are dwindling away and friendships no longer matter in the circumstances of life. Especially since Cat’s father told her not to trust the very people who took him and have been trying to create a cure.

The plot was incredibly interesting to me. I was completely absorbed and unable to look away. It barely mattered that I was staying with my friend because I finished this book in two days. It was amazing.

The author includes so many jaw-dropping moments in the 400 pages that truly leave you wanting more of her writing and world building.

C H A R A C T E R S

For this section, I’m only going to talk about the main character very briefly. I don’t want to give too much away within the book by talking about all the characters of importance and relevance to the story. I really feel Cat is truly the most important character, as well, especially with how this book ends.

#C A T A R I N A

I’m not too familiar with hacking or coding. Which may be why I stay very far away from dystopian and science fiction novels. Terminology is lost on me and I truly am just stumped. However, Catarina was the perfect main character. Sure, some parts were a tad confusing for me (but seriously, I know nothing about tech) but I really feel like each component was explained in a way that the most clueless person (me) could understand what was happening.

In terms of Cat as a character, she was incredible. I personally found her wholly unique and unlike any other character, I have personally read about. I absolutely adore discovering characters like that too, ones that are so unlike others. Cat had fear, she had distress and she had moxie (to reference one of my favourite books).

O V E R A L L

I’m incredibly excited to read more of Emily Suvada’s work. This Mortal Coil definitely hits straight into my favourite books of the year. It also hits one of the prettiest books I own because the pages on the UK/AUS version is gorgeous!

I also apologise since this isn’t my best review, I’m a bit out of sorts since it’s been a few weeks since I’ve written and I’m playing catch up on the few books I read. I hope that isn’t too much of a problem!
Profile Image for Suzzie.
969 reviews175 followers
June 25, 2018
Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was a really good read. I was really entertained by this book.

My quick and simple overall: very intriguing. It reminded me of a mix between Divergent meets the Walking Dead, which is pretty cool.
Profile Image for Kelly (Diva Booknerd).
1,106 reviews294 followers
November 14, 2017
The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now recaptured along with his assistant to manufacture an antidote.

Catarina has survived within the isolated Black Hills, a resourceful young woman evading Cartaxus capture. At birth, humans are implanted with advanced technology to allow gene manipulation, applications are downloaded to enhance humans physically, cognitively and aesthetically. Diagnosed with Hypergenesis, Catarina remains genetically unenhanced, relying upon her intellect and perception to survive. As the pandemic escalates, thousands shelter in underground communities, sacrificing their freedom to Cartaxus.

Although an agent of Cartaxus and a young man with enhanced abilities, disciplined in warfare, Lieutenant Cole Franklin has been assigned to protect Catarina after an explosion at the Cartaxus laboratory claimed her father and the vaccine. Humanity will depend on Catarina.

The essence of This Mortal Coil is genetic manipulation and biotechnology, developed by Lachlan Agatta and administered to infants as nanotechnology. It allows programmers to create applications that download directly into the body, collaborating with our human genetics. Cartaxus monopolises the genetic applications, abandoning and denying survivors essential health enhancements. The airborne virus infects healthy humans, accelerating before causalities detonate, bodies vaporising into a contagious, airborne cloud. Survivors can inoculate themselves by consuming the flesh of those infected, ensuring their immediate survival but Catarina is determined to preserve her humanity. The scientific elements are surprisingly uncomplicated and woven throughout the narration, rather than overhwleming expositions.

Catarina's relationship with her father Lachlan is portrayed as distant and indifferent, a young woman pursuing approval. Catarina begins a tentative relationship with Lachlan's assistant, a conventional young man who also appeared manipulative and egotistical. Their relationship seemed little more than based on convenience and no genuine connection between the two other than her father.

Catarina reluctantly establishes a companionship with Cole and I enjoyed their interactions. The attraction between the two is undeniable but Cole is preoccupied with the former Cartaxus programmer, the mysterious Jun Bei. Catarina is physically malnourished, she refuses to allow Cole to become her saviour and appreciated that although intellectually superior, is never pretentious or conceited.

Oh and those plot twists. Surprised eyebrows for days.

This Mortal Coil is an intelligent, captivating and atmospheric science fiction dystopian. Absolutely phenomenal.
Profile Image for Justine.
1,471 reviews397 followers
December 30, 2017
4.5 stars

Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book.
Profile Image for Jen Ryland (jenrylandreviews & yaallday).
2,163 reviews1,090 followers
Read
November 14, 2017
Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess....

So I did and I dislike virus books and am not a huge fan of triangles but ... I actually liked this.

First off, this DOES have a love triangle and if anyone says it doesn't, I'm not sure they understand the concept.

The main character has a guy in her (sort of) past, a guy who worked in her father's lab who she had a huge crush on and who has been cruelly ripped out of her life and out of the picture. She's clearly moping about him. Let's call him Gale. Whoops, sorry. Let's call him Guy #1. (Note to non-YA readers: a guy the main character loves who is "out of the picture" is just another way of saying TRIANGLE.)

So (of course) Guy #2 shows up, and he's been scientifically enhanced by her father to protect her and so has a sort of (in 80s movie references) The-Bodyguard-meets-The-Terminator twisted appeal. And because Guy #1 calls her "Princess" (kind of sarcastically, but still) I am SO voting for Guy #2.

Was this book slow? It didn't feel like it to me. Were the characters flat? Kinda, but that's a common thing in action-heavy books and I didn't find it a big problem. Was it the coolest sci-fi of all time? I don't read that much sci-fi but probably not. Was it one of the better YA sci fi books I've read recently? Yes.

This book had SO many tropes and yet ... I thought they worked, for the most part. A main character who's an odd genius/special snowflake with serious daddy issues. The love triangle. The sort-of forbidden love with the bodyguard, who is in love with a mysterious missing coder. A virus. A mysterious missing character.

In any case, this has a bit of a Walking Dead, vibe, a bit of a Stranger Things vibe, a bit of a Hunger Games with its badass, bad attitude heroine, a bit of an Everything, Everything vibe .... and similar qualities to a lot of trope-y YA books that I didn't write down as I was reading.

There's also a lot of science here -- coding and nanotechnology and viruses (both the medical kind and the computer kind ... I think) that I don't completely understand, but it worked well enough for me as a non-science person.

Looks like this book will be the first in a trilogy, so ... hoping this trilogy does not follow the YA Triangle Roadmap of Ugh.

If you like sci-fi and are not completely averse to love triangles, I say ... try it!

Read more of my reviews on JenRyland.com or check out my Bookstagram!
Profile Image for Liz Barnsley.
3,806 reviews1,081 followers
September 11, 2017
There’s no gene for Run Like Hell…

Or is there?

Stop the presses I’ve found my new YA trilogy obsession with Emily Suvada’s “This Mortal Coil” a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller.

Actually I’m assuming trilogy I guess it may end up being more but this is definitely book one and what a book one it is. For a start we have genuinely likable characters, none of whom are in any way generic, who you almost immediately care about and by the end of the novel you are entirely attached to.

Secondly Ms Suvada manages to avoid almost everything passe and overdone in your classic YA post apocalyptic story and makes the genre seem fresh as the morning sun – her romance threads are realistic, her relationship building is highly natural and the world building is subtle, immersive and well achieved. It’s also bloody clever. Rather than stick with your everyday virus she has created a truly fascinating, scientific geek heaven, honestly believable outbreak and rather than zombies she has….well I’ll let you find out that one for yourself.

The sciency (yes I know that’s not really a word) parts are really really riveting, the tech speak is easy to absorb within the narrative, it defines and drives the characters and sets us up for a lot of high thrills and spills action along the way. This is one of those truly immersive novels where you live in it for the moment, a proper page turner that will appeal to all ages, it is an adventure of the classic kind brought into modern times with socially relevant themes running throughout.

Seriously also it’s like a YA psychological thriller spun into a fantasy – it has often literally breathtaking twists and turns as our anchor to it all Cat starts to discover some horrific truths behind her honest belief system and starts to methodically yet emotionally untangle a web of deceit that shatters the very centre of her being. The ending will have you up out of your chair, a kind of fist pumping but dammit now I have to wait reaction that encompasses all that has gone before it into one big bubble of reading trauma. Don’t you love it when that happens?

Beautifully written, skillfully plotted with that touch of subtle intuitive storytelling that makes a book a word of mouth success, I am rather hopeful that movies and the suchlike will follow. We’ll see. But I get the feeling I just signed on for one HELL of a ride.

Highly Recommended.
Profile Image for Amelia.
177 reviews48 followers
September 24, 2018
I did really enjoy this book and can't wait to pick up the next book.

Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't.
Profile Image for Lia.
340 reviews90 followers
October 14, 2017
This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gasping with the many twists and turns.
dividerreview

What immediately grabbed me from the start and impressed me was the writing style. From the very first line, it intrigued me. The writing is vibrant and colorful, and I absolutely loved it. If a book can grab me with the writing, it says a lot, and this book could.

The premise itself is not that original, actually, it is not at all original at the first glance. It is about a girl surviving in a post-apocalyptic world, with zombie-like humans, corrupt corporations, and a plague. But despite its unoriginal premise, the story is completely new and different. It brings many new aspects and interesting things to the table.
Her words are clipped and sharp. She speaks the way a rife fires. She is steel and glass and blood fused into a blade.

I loved the gene-hacking and coding aspect to the story. There are many scientific descriptions about how it works, but it wasn't overwhelming. What Emily Suvada did really well is to describe scientific things in a simple but realistic way. The world felt so much more realistic due to the scientific aspect of the story. It also made me think about how gene-hacking (which basically means you manipulate your genes) would work in the real world and it felt like the things that happened there, would also be able to happen here.
The word was here before I was born, and it will be keep spinning after I am dead. The universe is continuous; I am the anomaly. I am the thread that begins and ends, the flame that sputters out. A chance collection of proteins and molecules that perpetuates itself, bound by the electric fire of my mind.

The characters were all really great and multi-faceted. I loved Catarine and Cole and I thought they made a great duo. Cat was smart and determined and wanted to do the right thing. She was also funny at times, which I really liked. The only character that I didn't really like was Dax (who is Cat's ex), but the sole reason for that was that he kept calling Cat "Princess".

The one thing that annoyed me mildly was the romantic storyline, which I thought was a little unnecessary. But that's probably just my romance-aversion talking.
'How are you feeling?'
'I feel like... I feel like I got shot in the back.'
'That's a common side effect of getting shot in the back.'

The book is mildly disturbing, has many plot twists you never see coming, and is brilliantly woven into a story that you won't forget easily. I am giving it 4.5 stars because it was gripping and had amazing writing. I really loved it! I am not giving it 5 stars because the romance was a little unnecessary and there was no diversity in it.
Profile Image for Waqar Arif.
18 reviews24 followers
June 13, 2018
BANG! Did that roller coaster just stop for a while?
Woah! I wasn't prepared for such a fantastically written sci-fi thriller.
This book got everything. To name a few, I experienced some razor sharp action, last minute escapes, a lot of seriously great plot twists, powerful dialogues, humour, slow burn romance & that totally unexpected ending! Man! I wasn't prepared for that 😨
In a sense, this book was just like a peel of onion! You have to keep separating each layer till the root 😌
The lead protagonist, Catarina Agatta was a clever, cunningly audacious hacker. After facing a huge traumatic incident, now she only had one mission: To fight Hydra virus which is an imminent threat to mankind. Her struggle was greatly portrayed throughout the book. Her 'unexpected pair' turned the tables and it completely changed the gesture of storyline.
To conclude, I'm greatly impressed by reading such a brilliant debut novel *And also raging inside. How can she left me at that cliffhanger* 😣 I'll be really looking forward to continue this series in future 😌
Profile Image for Emma♔☯ (Bookishfix).
182 reviews50 followers
April 23, 2018
“There’s no such thing as right anymore - that ended when the plague hit. Sometimes we need to do awful things to stop worse things from happening. You’re still thinking in terms of right and wrong, but this is war, and the rules have changed.”


This was an interesting novel, should you always believe in the hype though? No, of course not, sadly this is my mistake time and time again, believe the hype because that's where my expectations go crazy high and I expect perfection in every part of the story.
Although I enjoyed this book I dont believe its as amazing as everyone says it is, I mean yes some parts were amazing, but not the book as a whole.

In a post-apocalyptic/dystopian time, the Hydra virus has traveled across the globe, killing many and still waiting to infect those that have survived. Rolling in like dust clouds, there is no cure, but there is a rather brutal way of immunizing one's self for short periods of time.
In this futuristic world, gene hacking is the norm; Everyone having a panel in their arm where apps to improve their bodies(improve eyesight, strength, cure diseases, etc) can be downloaded.
Catarina Agatta is a skilled hacker and survivor, with her geneticist father taken two years before by Cartaxus, a suspicious government company, she now lives alone trying to survive.
When a Cartaxus soldier, Cole, comes to her, with a message from her father before his tragic death, Catarina isn't sure what to believe. Her father has left her instructions on how to release a vaccine into the world but a soldier from Cartaxus cannot be trusted, not after taking her father away from her. Together, Catarina and Cole must survive, steal and decrypt in order to save the world from the Hydra virus.

This is a fast-paced, action-packed ride, with heaps of science fiction.
My favorite part of this story was definitely the science fiction aspects, the hacking, the virus, the mutations and the panels. My nerdy heart was living for every part that went in depth about the science aspect of things. Not only was it well done but it was also really easy to understand, which makes me think ALOT of planning went into creating this world. Which leads me to the world building, it was really well done and thought out to every last detail.

I enjoyed the characters, although I dont like the directions their stories went, the romance and love triangle especially. It felt kind of lacking when it came to reveals as well, and it was a little too tropey for me personally. Cole also has this protection protocol thing with Catarina that her father installed in him, meaning he pretty much sees her as a defenseless girl with no ability to protect her whatsoever although she lived alone and survived for two years! I get her father just wanted to make sure she was protected by holy fuck it annoyed me.

The ending for me wasn't the strongest, it was unique sure, but I left the book feeling a little letdown AND I BLAME THE DAMN HYPE!

In saying this, I will continue on with the next book as I would like to see where the story goes especially when it comes to the characters and the world itself.
Although this book wasn't as amazing as so many others said it was, and the hype may have contributed to my high expectations and my disappointment in some areas, there are aspects I really enjoyed and cannot wait to see more of.

Recommended for: Science Fiction/ YA/ Dystopian
Profile Image for Ken.
380 reviews88 followers
February 6, 2022
Emily Suvada has smashed it and honestly was drawn to that title "This Mortal Coil" it just envokes tingles all the way down too my toes, plus that cover something exploding into a blob of red bloody mist and well the fact there is a soldier in it must mean a whole bunch of zombies are going to die for a second time and be really dead for real. Also what the hell, it has a super crazy genetic language lingo which no mere peasant could possibly understand all mixed in together it's just a chaotic messy fast paced action packed drama total fun factory a dystopian nightmare that you better pray, hands clasped, bended knees, that it never comes true.
Profile Image for destiny ♡ howling libraries.
2,030 reviews6,222 followers
Want to Read
February 24, 2019
This is REALLY good, I'm just not in a sci-fi mood right now and I would rather save this for when I am so that I can enjoy it as much as it deserves (because, no doubt, I bet this is going to be a 5-star read for me when I pick it back up).
Displaying 1 - 30 of 2,168 reviews