Jump to ratings and reviews
Rate this book

This Mortal Coil #3

This Vicious Cure

Rate this book
Cat is desperate to find a way to stop Cartaxus and the plague in this gripping finale to a series New York Times bestselling author Amie Kaufman says “redefines ‘unputdownable!’”

Cat’s hacking skills weren’t enough to keep her from losing everything—her identity, her past, and now her freedom. She’s trapped and alone, but she’s survived this long, and she’s not giving up without a fight.

Though the outbreak has been contained, a new threat has emerged—one that’s taken the world to the brink of a devastating war. With genetic technology that promises not just a cure for the plague, but a way to prevent death itself, both sides will stop at nothing to seize control of humanity’s future.

Facing her smartest, most devastating enemy yet, Cat must race against the clock to protect her friends and save the lives of millions on the planet’s surface. No matter the outcome, humanity will never be the same.

And this time, Cat can’t afford to let anything, or anyone, stand in her way.

416 pages, Hardcover

First published January 21, 2020

Loading...
Loading...

About the author

Emily Suvada

7 books872 followers
Emily Suvada was born and raised in Australia, where she went on to study mathematics and astrophysics. She previously worked as a data scientist, and still spends hours writing algorithms to perform tasks which would only take minutes to complete on her own. When not writing, she can be found hiking, cycling, and conducting chemistry experiments in her kitchen. She currently lives in Portland, OR, with her family.

Ratings & Reviews

What do you think?
Rate this book

Friends & Following

Create a free account to discover what your friends think of this book!

Community Reviews

5 stars
968 (34%)
4 stars
1,132 (40%)
3 stars
596 (21%)
2 stars
105 (3%)
1 star
19 (<1%)
Displaying 1 - 30 of 361 reviews
Profile Image for Emily Suvada.
Author 7 books872 followers
January 21, 2020
ACTGAGCTTGCTCATGAGCGATGGTCGTCATGTCCGTGTAAAGATTTTACCCTCCGACCCTCCCTGCGAGCCATCAGGCTTCGTAGACTCCTCGTGTCGACATGAGCTGGTTTCGCCAACAGGCTACCTCGCTCACTCCGACCAACGATTAGACCATGTTTCCTAATGAAGTCGCTTGGATAGGTCGAGGCGAGCTCGTCAACTCGGGTGGCACCTACCAGATGTGGAAACCACCTCAAGACCACCGGTCGCTCAGACGCTACCTTGTATTATGCTAGCATCGTGGGCTCCGTACTAAGTATTATGGTCGACACCACCGGACCCAAGTACCTTCAC
Profile Image for patrycja ୨୧ ‧₊˚ .
186 reviews269 followers
August 10, 2025
— 3 ★
⊹ "memories can be precious, but sometimes they're just a burden. a wound that won't ever heal." ៹࣪
⭑𓂃 ⌗ my thoughts

what a good conclusion to this story!! i couldn't get into it at first, but i think it was more of a me problem, because i had a huge headache which made it hard to focus. when it went away, i got super hooked & just couldn't wait to find out how the story would unfold! and which direction it would take in the first place...👀 it was such a wild ride. though ngl, sometimes there was so much info to process that my brain was REELING. like please one information at a time! anyway, i love how all of it came to an end 😛

⭑𓂃 ⌗ quotes

"this is what leading people means, jun bei. it's not always about marching them to victory. sometimes it's about standing with them when they fall."

"there's no point in fighting for a future when we won't be able to live with the things we did to reach it."

"whatever people do to animals, they'll eventually do to their enemies. and whatever they do to their enemies, they'll eventually do to one another."

"this outbreak has broken us. I don't know if people will ever get past it if we keep living with the pain of the last two years."


⟡ — pre-read !

and onto the last one 🫡 i'm terrified to find out what this one will bring me
Profile Image for Alyssa.
104 reviews3 followers
March 17, 2020
4.5

Emily, if for some reason you read this, thank you so much for writing this series and giving me something to love so dearly when I was in the darkest moments of my life.

Hm... okay. Initial thoughts: Did I think I hyped this up a bit too much in my head to the point it was unrealistic that any book could meet them? Yes. Did this book *nearly* meet them? Also yes. I really enjoyed this. I loved the dual perspectives and being able to see the relationship dynamics with everyone was great. It was fast paced and my jaw dropped like a gazillion times. This whole series is amazing and I'd reccomend it to anyone.

THAT BEING SAID, I was *extremely* confused. I know that's more of a me problem. Because I'm big dumb, I'm not in a reading mood, kind of depressed so my brain isn't working, and I read this while listening along with the audiobook. (Speaking of, I swear they recorded the audiobook using an advanced copy or a UK edition. Things just didn't match up sometimes). I'm known to zone out sometimes while listening to an audiobook, so when I reread this (which I will) I will just read with my eyes and hopefully be able to grasp the story a bit better.

Either way, still loved this, still cried, still want more in this world with these characters (i need a series with Anna as the MC asap EMILY PLEASE), and I will hold this series near and dear to my heart for the rest if my life.

The first book in this series was a fun, entertaining light in a really dark time in my life. I was so hopeless, and being able to escape into such a wonderful story made my days so much better. The second book came around and destroyed me in the best way possible, and now this book gave me another escape during this pandemic we're currently in. Which, now that I think about it, probably not a good time to have been reading a book about a global pandemic-level virus... oops.

UPDATE: After 2 weeks of amazon being an absolute shit company, my pre-order came in! Hooray for me! Still need to re-read the first two before I dive in.

UPDATE: HOLY SHIT WE HAVE A COVER AND IT LOOKS SO. DAMN. COOL. IM SHOOK. I KNEW IT WOULD BE GREEN I GOD DAMN KNEW IT. ALSO THE TITLE HAS ME KINDA SUS NGL BUT EMILY I KNOW THIS'LL BE AMAZING I CANNOT WAIT

We're getting a third book and I'm so shook I thought it was a duology!!! THANK YOU EMILY
Profile Image for Patty (IheartYA311).
1,343 reviews
May 10, 2020
I generally do not like to read (or finish) books of a series, and unfortunately This Vicious Cure fell slightly short-of-fantastic as the finale of a trilogy. I tend to either get bored or find the story tedious after book 2 of a series. Book 2 was not as good as 1, and book 3 not as good as 2. The story seemed to derail and felt drawn out. Parts were jumbled and moved too quickly while others lacked focus to move the story along. The writing style, world building and characters were kick ass, as usual. 3 stars for book 3. 4 stars for the trilogy as a whole and I still do recommend it as because it's amazingly original.
Profile Image for Kelli W.
646 reviews181 followers
January 27, 2020
This was a fabulous ending to a great trilogy! I'm thrilled to say that the final book was the best of the series. After talking with a few other goodreaders it seems this series has been underrated so far. If you enjoy post apocalyptic, exciting and fast paced then definitely check this series out!
Profile Image for Jessica {Litnoob}.
1,305 reviews97 followers
March 25, 2024
“Whatever people do to animals they’ll eventually do to their enemies. And whatever they do to their enemies, they’ll eventually do to one another.”



Y’all 😭 it’s over and I wasn’t ready! This series has been an instant favorite to me for so many reasons. Weird coding science I’m totally not smart enough to understand but wish I could? Sign me up! An entire cast of morally grey completely untrustworthy characters? Yes please! A fight over what it means to be human, and what makes a family? That is my jam! And we get all of that from this trilogy. It’s always fast paced and never easily slows down. Bonus in this one we get a dual perspective that really shines a light on how people can make every possible wrong decision for the right reasons. I will for sure be rereading this series again and again when the mood strikes. It just speaks to me that much.
Profile Image for The Nerd Daily.
720 reviews391 followers
Read
March 13, 2020
Originally published on The Nerd Daily | Review by Louise Nice

This Vicious Cure is the third and final book in Emily Suvada’s This Mortal Coil trilogy and it is a fantastic gene-hacking based book that is set in a post-apocalyptic world. This Vicious Cure certainly cured the need to know how the characters ended up fairing at the end of this series!

Before delving into why I loved This Vicious Cure, let’s recap book 1 (This Mortal Coil) and book 2 (This Cruel Design). In This Mortal Coil, we meet Catarina and Cole, who live in this future world where the virus Hydra has forced many people into bunkers run by this corporation by the name of Cartaxus. Cole is a soldier from Cartaxus who has delivered a message to Cat that her father, Lachlan Agatta, is dead. This sends them on a gene-hacking and butt-kicking journey to uncover the truth behind Lachlan’s death. In This Cruel Design, we meet Jun Bei, Cole, and Anna, who are lab-made humans and they work with Catarina to attempt to make a vaccine for the Hydra virus, whilst on the run from both Lachlan and Cartaxus. In these books, there is a bit of gore, and a slightly weird romance, but I loved it, so obviously I read This Vicious Cure!

Ultimately, This Vicious Cure was 100% a strong finish to the series. I enjoyed the alternating dual perspectives between Catarina and Jun Bei, who are seemingly rebuilding their lives after the events from This Cruel Design. I loved seeing all the characters I loved back in this third book (including one of my favourites from book 1 and Lachlan Agatta- someone you’ll learn to love to hate!), as well as seeing them all work together to again try to beat the Hydra virus.

Whilst I did appreciate the dual perspective, I felt that it was lacking a little bit more from the other characters that were important across the first two books, such as Cole and Lachlan; they both were portrayed as more insignificant characters. However, I think the limitations from Cole could’ve been because Catarina was locked into a virtual simulation and couldn’t have in-person contact with anyone.

I thoroughly enjoyed reading all the technical terms that were used throughout the book, as I could actually see how it all worked together, as I am currently studying gene editing myself at the moment, however I feel like this could pose a problem for people who have forgotten all the terminology between books. It was enjoyable how the revelations throughout were not just conveniently there, instead, the characters had to dig around and figure out what was actually going on! The action and the gore was also still super consistent in this book, and kept me thoroughly gripped and wanting to know why these things were happening. The descriptiveness of the events that happened in this book were surreal, and in the world that has been clearly so delicately built, it feels like things like that could actually happen in real life. I mean hello, we already have the CRISPR/Cas gene editing technique that’s taken the world by storm, close enough, right?

Whilst I totally did not expect the ending of This Vicious Cure to be what it was, I’m quite satisfied with it, and as a whole, I’m totally satisfied with the series and now one of my favourite dystopian sci-fi series.
Profile Image for Nicole.
450 reviews65 followers
July 12, 2020
I think this was a very fitting end for the series. And I highly recommend this series. Although reading it during COVID is a bit odd
Profile Image for Yana S.
70 reviews1 follower
June 12, 2020
"Этот разрушительный элемент" – это просто какой-то слив года. Читала первые две книги серии недавно и очень хорошо помню, какая там была атмосфера, как от книг невозможно было оторваться. Тут же корпела над страницами больше недели, потому что постоянно находилось что-то более увлекательное. Определенно ясно одно: у автора были наполеоновские планы, но она их так и не затащила.
– Значит, ты не считаешь меня чудовищем?
– Мы чудовища, Цзюнь Бэй. Вот во что они нас превратили. Но это не означает, что мы не можем сделать что-то доброе для этого мира.

Действия в третей части серии происходят примерно недели две после событий "Этого жестокого замысла". Всем людям стерли пару недель памяти, вакцина конкретно барахлит, гидра распространяется, а люди поддаются неподконтрольным приступам гнева. И половина героев ничего с этим не делает. Дзюнь Бэй занята изобретением своей фигни для бессмертия, а Катарину виртуально привлекают к сборам старой доброй команды с проекта "Заратустра", чтобы исправить вакцину. Главы в книге идут от лица обеих девушек, постоянно чередуясь, и это очень сильно отвлекало – вот что-то интересное произошло с Катариной и хочется узнать, что с ней будет дальше, но фиг тебе – читай скучную главу Дзюнь Бэй.

И говоря "скучно", я действительно имею в виду, что было скучно. А я ведь губу уже раскатала после предыдущих двух книг, размечталась, что за три дня проглочу финальную часть, а она все тянулась и тянулась. Катарина изобретала вакцину, но как-то так вяло, что всю книгу они с Анной и Коулом просто куда-то ехали и что-то искали, и это что-то в итоге нежданно и негаданно находило их, чтобы сюжет хоть куда-то двигался. Дзюнь Бэй тоже прыгала по локациям, размышляя о смысле своей жизни и том, кем же она является – хорошим человеком или плохим. И эти ее резкие смены намерений так бесили: вот она нарочно хочет убить людей, чтобы проверить свою "Панацею" или бессердечно поступает с Коулом, а вот уже думает о том, что убивать людей плохо. Сложилось впечатление, что автор пыталась нарочно ее обелить, чтобы подвести к тому финалу, который запланировала.

Многие герои в этой книге превратились в подобие мебели. Коул и Анна, например, которые фактически ничего не делали и никуда сюжет на вели, Дакс, который управлял "Картаксом" фактически не управляя "Картаксом", Лаклан, который в двух главах появился. Некоторые персонажи же не изменяли себе и как были мебелью, так ею и остались. Новак живой тому пример, потому что появлялась в книге исключительно для того, чтобы безвозмездно всем и всячески помогать в необходимый для этого момент (в первой части она была той еще гадиной, но внутри оказалась добрейшей души человеком!).

В любовном плане тоже произошел какой-то скачек назад, причем для всех парочек. У Коула остались какие-то обрывки чувств к Катарине (но при этом его как-то не особо парит та самая часть потерянных воспоминаний…), Катарина испытывает что-то к Коулу, но у них не будет ни единого момента, чтобы с этим разобраться. Они даже поговорить наедине не смогли ни разу за всю книгу! (потому что определенно были заняты, творя какую-то очередную дичь). У Дзюнь Бэй с Коулом и Мато происходило ровно тоже самое: были моменты какой-то близости, но в следующей главе никто об этом словно даже и не помнил. Не знаю, какой был смысл в таком приеме, как по мне, он книгу ничем не скрасил и даже обесценил очень крутой ход со стиранием воспоминаний.

С научной составляющей в серии определенно что-то не складывается – хотя бы потому, что я со степенью магистра в биотехнологии так и не смогла сложить все в целостную картину. Моя пдруга, тоже читавшая книгу, как-то сказала, что Эмили Сувада описывает генетику как балет, и я пожалуй с ней согласна. С происхождением гидры все вроде как гладко, как и с ее мутациями, но это их создание вакцин… Что они там через кого пропускают? Как все-таки работают чертовы панели? Почему они в этой части серии так просто создали и вакцину, и "Панацею", и почему снова ничего не тестировали, а сразу заливали людям? Ну хоть история про происхождение Катарины мне понравилась. Это конечно вообще не реалистично и даже невозможно, но хоть интересно было.
Нет смысла бороться за будущее, если ты не сможешь жить с тем, что сделал ради его достижения.

Финал был какой-то слишком быстрый и простой. Большую часть книги герои просто где-то болтаются в пространстве, пытаясь собраться в какой-то одной точке, а на решение всех проблем с гидрой выделено глав пять. Злодеи вообще оказались душками и забросили все свои планы коту под хвост, да как давай всем помогать! И все решилось так хорошо, и все счастливы! Мне упорно не хватало какой-то горчинки, прямо хотелось, чтобы кто-то все же пожертвовал собой. И еще какие-то новые голуби в конце… Вот у меня душенька прям просила вместо нормального финала прислать стайку голубей, и Эмили Сувада исполнила напоследок мое желание!

Все же я поставила книге 4, отдавая должное идее, технологической составляющей, некоторым крутым сюжетным поворотам. И для написания серии на самом деле была проделана колоссальная работа, но для финала такой истории этого оказалось мало. Мне хотелось большей глубины, большего погружения в происходящее, потому что чего еще можно ожидать после шикарных предыдущих частей? Но получилось, что они создали плохой контраст для "Этого разрушительного элемента", и книга на их фоне существенно блекнет. Я, конечно, не жалею, что закончила серию, но от нее определенно не стоило ожидать столь многого.
Profile Image for ᒪᗴᗩᕼ .
2,202 reviews190 followers
January 31, 2020
MY RATING⇢ 4 ✰STARS✰

BOOK TAGS⇣


SCIENCE FICTION DYSTOPIAN YA GENE-HACKING, SPLICING & TECHY TERMS ACTUALLY A LOT OF IT WENT OVER MY HEAD SPLASH OF ROMANCE A ZOMBIE-LIKE VIRUS

MY THOUGHTS⇣

In my review of book #1 (This Mortal Coil), I stated that "this was completely comprehensible and a seriously compelling story, especially for a book involving gene hacking, splicing, decoding and lots of technical terms and such". In my review for Book #2 (This Cruel Design), I stated that "I wished I could say that this book was the same for me...and it almost was, I just got a little lost in the beginning (and maybe, a little throughout)...but, eventually things started clicking for me". For this book (#3) I was feeling even more confused by all the technical terms and such and things took a tad longer to click. 😕

I'm certain that if I had waited to read all three books together, or at least somewhat together instead of a year apart, I would have been able to retain more of the techy-talk, the plot and the multiple characters. I was basically left reeling for the first third of the book. My advice; read these books as close together as you can, I'm positive that I would have rated each story 5 stars if I had. Someday maybe I'll binge these books...although I may decide that I don't like the narrator enough to do that. Her voice was a little grating after a while.

Even with all my issues, I still found this series to be smartly written, with an exceptional plot-line...it surprised me with the many twists and turns it takes throughout, it's definitely not predictable and I wholeheartedly recommend to anyone who likes science fiction.

BOOK DETAILS⇣

AUDIO PERFORMED BY⇢ SKYE BENNETT
NARRATION RATING⇢ 3.5/5
BOOK COVER⇢ IT MATCHES ALL THE OTHERS...
SETTING⇢ A FUTURISTIC UNITED STATES
SOURCE⇢ LIBRO FM AUDIOBOOK
AUDIOBOOK LENGTH⇢ 12 HOURS, 11 MINUTES


BREAKDOWN⇣
Plot⇢ 4/5
Characters⇢ 4.3/5
The Feels⇢ 4/5
Pacing⇢ 4/5
Addictiveness⇢ 4/5
Theme or Tone⇢ 4/5
Flow (Writing Style)⇢ 3.5/5
World-Building⇢ 3.8/5
Originality⇢ 5/5
Ending⇢ 4/5

description
Profile Image for Erin.
774 reviews5 followers
January 24, 2020
Time spent waiting until I could get my hands on this book: over 12 months
Time spent reading this book: a day and a half
Now what the hell am I supposed to do with my life??

I have just finished this final book in this awesome series, and I now have that melancholy feeling one gets when you’ve spent so much time and felt so many feelings in a wonderfully crafted world, and that’s it. It’s done. It’s all over.

This Vicious Cure was a fitting conclusion to the trilogy and it really epitomised the strength and importance of our humanity, and that the only way to lead others is to do it with heart.

I’ve really admired the work of the author across these three (and a bit) books, particularly the growth of the characters, the fast-paced, action packed, addictive storylines, and the ability to maintain the thrill throughout the series. Being jacked into these books was like a low-level hum, my surrounds became white noise, and I was singularly focused on reading the next chapter, and the next after that, and the next, and the next...because it’s impossible to find a suitable place to set them down.

I’ll miss these characters, and this incredible world. But I’m definitely thinking that a revisit is on the cards at some point in the future.
Profile Image for Shelley.
5,646 reviews489 followers
March 5, 2020
*Source* Library
*Genre* Young Adult / Science Fiction
*Rating* 3.5-4

*Thoughts*

This Vicious Cure is the third and final installment in author Emily Suvada's Mortal Coil trilogy. What you should know: A virus nearly brought humanity to the very brink of the apocalypse. Hydra was a virus that caused spontaneous combustion in humans called a Hydra cloud. There was a cure found, but things aren't as peaceful as one might think. For this final installment, the author actually alternates chapters between two main characters. One is a power hungry young woman (Jun Bei) who wants to fix what she's broken even if it means controlling others to do so.

*Full Review @ Gizmos Reviews*

https://gizmosreviews.blogspot.com/20...
Profile Image for Hedi.
364 reviews42 followers
December 21, 2022
A very good conclusion of an amazing science fiction series! I loved we got a duel perspective for Jun Bei en Catarina, because I didn’t know how we would continue after the events in the last book. They were so different and morally grey with i always love in a character!

I would the virtual world thing to be a bit much and an easy ploy for Catarina to be included in the story.. but it would have been better. Also Anna gets in my nerves so much, i hate her with a passion. I also loved that it wasn’t centred around the romances, yes it was there.. but it wasn’t the focus of this story. I loved the deeper meaning and a bit of a warning for our own future. Great series!
Profile Image for TheGeekishBrunette.
1,430 reviews41 followers
February 20, 2020
Well, guys. I finished the series. I’m so glad I started the first book in December so I didn’t have to wait long before the ending came out. I will say that overall I am pleased with how the last book turned out. I’m just disappointed with two tiny things (maybe 3, ha).

There is no way to make this spoiler free so read at your own risk. You have been warned!

The book is split into two point-of-views: Catarina and Jun-bei. I liked this set up because it really added to the suspense and the plot. There were times I disliked one or the other more. They both were just trying to do what they deemed necessary for the entire world and sometimes that led to not thinking things all the way through.

Dax, Leoban, and Cole come into the story pretty quickly. I will say that they don’t play too big of roles in this book. They are present but not like before. I was okay with it since it didn’t take away from the plot.

There are other characters that come back and new there are also new faces. I didn’t see Agnes coming back and was pretty shocked to learn that she had to do with the madness that was going on! But, I didn’t like her being the bad guy and then just changing her tune dramatically and going along with whatever they said. I just like inherently bad people!

The plot was intense from start to finish. I didn’t see any of the plot twists coming. It was definitely hard to put down and I felt like I had to read because my life depended on it. This author definitely knows how to keep you on your toes.

I already covered one thing I didn’t really like and the other thing I just didn’t understand was the newfound relationship, whatever you want to call it, between Leoban and Dax. It doesn’t make any sense to me since there was nothing ever hinted from any of the other books. I don’t know, maybe it’s just me?

I did think that it ended nicely but it was too open ended for my taste. I like closure and not something that makes it seem there is more! I can only hope that she will eventually come back to these characters.

Overall it was still a great read and I’m glad that I enjoyed the series as a whole.
Profile Image for Nova Syzygy.
638 reviews40 followers
February 15, 2020
Well...this was...underwhelming. I was expecting an emotional roller coaster, but instead I got...nothing. The greatest emotional reaction this got out of me was some mild sadness when Mato (my favorite character) died. Emotion-wise, the first book was the best, but plot-wise, this is the best out of all of them. I think my apathy might have something to do with having really high expectations for a book. So far, the sequels I’ve really wanted to read for months have turned out disappointing, and I’m beginning to see a pattern. However, the books I didn’t expect to like impacted me a lot, and it still hurts to think about them. Maybe I should lower my expectations for sequels...

Full review to come later. (Edit 2/15/2020: no.)







Pre-read Review:

Update:

I NEED THIS BOOK
N O W
.








IT HAS A COVER. IT HAS A COVER. IT HAS A COVER.

ITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVERITHASACOVER!!!!!!!!

I hope that this will be everything I want it to be. The second book fell a little flat, and I hope, I really, really hope that this will make up for everything. It has to.
Profile Image for Grace.
329 reviews2 followers
February 24, 2020
I just love this series, I'm sad this is the end! All three books are so cleverly written and Suvada has created such an amazingly detailed world. The world she has created details a future which I could see possible for us, especially in terms of the development of genetech and the issues that surround it.

This book is taken from the perspectives of both Jun Bei and Catarina, which means the story can develop from two points of view. The reader gets a deeper exploration of many of the characters from previous books to which is great.

I'm sad to let this series go, but you bet I'm going to be rereading it many times in the future. I'd recommend it to everyone, especially those who are big fans of sci-fi!!
Profile Image for Kelly (Diva Booknerd).
1,106 reviews294 followers
March 9, 2020
Strong, remarkable women as heroines, villains and the morally ambiguous surviving against all odds. An airborne virus morphing formerly healthy individuals into bloodthirsty monsters and an all encompassing corporation determined to regulate and manipulate the civilian population as opposed by a community of genehackers. A science fiction thriller blending friendship, romance and a revolution of mammoth proportions.

The This Mortal Coil Trilogy is an intelligent, captivating and atmospheric science fiction dystopian. Absolutely phenomenal.
Profile Image for Ayla C.
74 reviews21 followers
February 14, 2020
Where should I start... Like the previous books in the series, This Vicious Cure doesn't have the most beautiful prose of the best characters ever, but if you love this series for the story and science--I definitely do!--you'll forgive it for its flaws. Really, just the originality and, oh, the goosebumps-inducing logic, earned it 5 stars from me.
Profile Image for Kayla (krakentoagoodbook).
909 reviews102 followers
February 23, 2020
Ok, wow. This was a very satisfying conclusion to the series. We get more insane reveals and things kinda come full circle. The dynamics between all of the characters were great, and I definitely liked seeing how everyone grows over these books.
Profile Image for Kelly.
971 reviews137 followers
March 28, 2021
3.5 stars

I think this series is A M A Z I N G. The mind that built this world and the tech that runs it is operating on another level and it's genius. I loved reading about everything from the gene-hacked pigeons, to the explanations about how viruses and vectors work, to the coding. Book 1 is an incredible introduction into this dystopian future. Book 2 was a high-octane kick in the face that introduced us to Regina and Entropia and propelled the story to dizzying heights. But Book 3 didn't quite tie it all together. It left me with questions, doubts, and dissatisfaction. It just became so convoluted and the characters got lost in this raging tsunami of code. They got lost trying to save the world because the plot grew to ginormous proportions and the stakes never knew when to stop growing exponentially. It's like Suvada couldn't stop herself - she had to cram it all in there, every single fascinating idea she had in her brain - and it was too much. It swallowed this book whole. I wanted a more thoughtful and measured version of Books 1 and 2, one that maybe slowed down a little, rather than dialing things up yet again. One that took a little more time getting to the brink of the end of the world. Just as Jun Bei is on the verge of collapse (I mean, these people never eat, rest or sleep - never), so was I as a reader. I let the momentum of the book carry me, but was I actively enjoying this like I did the others? Much less so.

Here are some of the reasons why:

It got too complicated and felt forced In spite of reading this trilogy within the span of a month, I still feel confused on some of the plot points. And there are about a million plot points, so this is probably natural. This book just kept pounding my brain with twist after twist after twist, without giving me (or the characters) enough time to take a breath and give a moment's thought to the consequences before the fallout of the latest twist swept us all into the next. Honestly? It was too much. I kept wondering how much of this had actually been plotted when Suvada came up with the idea because part of the problem seemed to be making this stretch to fit a principle stated in Book 1 which morphed into something different by Book 3. Some examples:

- e.g. Cat and Jun Bei being "grown" side-by-side in tanks, half-sisters sharing Lachlan's DNA, and then Jun Bei hosting Cat's "invasive" cells until Cat "woke up" inside a mind she had taken over, using Jun Bei's brain as a host - this plot point is so complicated. Wasn't it enough when Jun Bei "woke up" inside Cat's mind in Book 2? I understand why the plot needed this plot point to be real, but wasn't this twist on the twist so over-the-top?
- e.g. Agnes - when Cole shows up in Book 1 and Agnes is nowhere to be found, after taking care of Cat for 2 years during the Outbreak, is Suvada really positioning Agnes to be the Viper? Or did we just need a Viper and we had Agnes as a character we knew (but who was going nowhere) and so the hand fit the glove? Because it was way too obvious and the reveal of Agnes as Viper was not surprising, but just felt wrong. Even Cat comments repeatedly about how wrong this reveal feels; she can't seem to align the two versions of Agnes - Viper and Yaya - in her mind, and neither can I as a reader. It was also way too convenient that she was behind the Lurkers, the pigeons spreading the virus, and the attack on Cat after the virus is released and the whole town goes crazy and turns on one another (and Dax tries to kill Cat). Poof - Agnes was behind it all. How? Why? No explanation was given.
- e.g. Um, if Lachlan has basically been experimenting for Cartaxus under lock and key, how - after Jun Bei escapes - does he just up and leave Cartaxus, find a little cabin right next to the Viper, and raise Cat? Without the vaccine complete, wouldn't Cartaxus have flown him back to a lab and forced him to work? It doesn't make sense that he was able to escape for two years, especially after he has run off with one of the test subjects from Gemini - Dax. (Side note: This was another plot line that was never fully fleshed out - the Mato and Dax experimental subjects plotline. They're "brothers"? Too complicated. We didn't need an explanation as to why both are gifted coders, and I'm not sure that was even the proper explanation - "they were grown that way".) I also don't buy that Lachlan, who had been working with Hydra for 30 years, didn't figure out that all of gentech was based on Hydra. I mean, you're talking about the most gifted geneticist in the world and he couldn't figure it out?
- e.g. Another really obvious example is Veritas. Suvada had to give Cat a role in this book, and as a dormant personality living inside of Jun Bei's brain, she just didn't have many options. Hence - Veritas. An incredible VR that lets her jump from any "eye" - camera, ocular tech, etc. - into the action. This just popped up in Book 3 and, if you want to get technical, would have changed a ton because it would have meant Carataxus could use Veritas to spy on anyone (including the genehackers) and no one would be able to hide from them.
- e.g. The Scythe - Cartaxus has the Scythe in Book 2. Then how can Jun Bei and Mato still use it in Book 3? Suvada goes to great pains to ensure they don't use it on anyone in Cartaxus, but that already happened - didn't it?

The Dual Perspective - it worked, but it didn't I also had issues with the dual perspective. So. Much. Happens. In this book, and having the narrative split just means that we have double the action - what is happening with Jun Bei and what is happening with Cat, until they meet up. Because both narratives are told in first person, once Jun Bei's and Cat's storylines merge, I started to get a little lost with who was speaking. They're both "I" and they're both seeing the same thing. Their voices were not distinctive, and I lost whole conversations thinking Cat was speaking when it was actually Jun Bei.

The Memory Wipe Cat was lost inside of Jun Bei, and so much was lost because of that. Characters that I loved - like Cole and, yes, even Cat - were just not as present in this book. The plot device at the end of Book 2 - having Jun Bei wipe the memories of people so that they could "heal" - caused so much damage in Book 3. Things were already strained between Cole and Cat - this just took them all the way back to the beginning of Book 1, before they met. That was frustrating. Everything that had been building got erased - not such a smart move for fans of the series. Also, I don't think the memory wipe helped anything or upped the ante - did it give Cat and Jun Bei an advantage? Why were some people's memories affected and others' weren't? Did Lachlan, the Viper, and Dax have their memories wiped? It doesn't seem like it. Why not? This series would have been more powerful if that plot device had never been executed.

I wanted more emotion. We're talking about massive plot twists, identity reveals, Cole losing his tech, the world ending, Agnes turning out to be the Viper, Regina being dead - but we don't get much. There are no moments when Leoben and Cat are living in the Jeeps, healing and training, or when Cat and Cole are talking about what they'll do after all this is over, or even any sister-sister bonding moments (Jun Bei just takes off, and that "pigeon message" she sends at the end just did nothing for me). These people's eyes are glazed over, they are coding or they're blasting their way out of some trap, and there just isn't time to deal with the consequences - and that's a shame.

I would so love another adventure with these characters. I want Cole and Cat to be living in a tent under the stars in Australia, talking about their past adventures and their friends, and for a small mystery to crop up, one that only they can handle. But it should be a Nancy Drew-sized mystery, not an oh-my-God-the-world-is-ending-AGAIN mystery. One that tackles one of the "that didn't make sense" plot points listed above and fills in the gaps. I'm so on board for that kind of continuation of the series!
Profile Image for Kenia.
256 reviews
August 2, 2020
I waited to read all three before putting together a review. I wanted to review the series as a whole.

Book 1:

The Mortal Coil was really good, I gave it a 4 star rating. First books in a series are always jam packed with information and sometime we can get lost in that info. But with MC I didn’t get lost in the info I actually took interest in the information given. It allowed me to understand what the author intended for the virus. For the characters Kat was interesting but not so much in the beginning. She was a mystery which I did take interest in but it was Cole I wanted to know more about. Book one really set its claws in and I had to find out what happened next immediately!

Book 2:

The Cruel Design didn’t disappoint either, it picked up where we left off. Kat knowing she wasn’t just Kat she was also jun bei, but there was still so many questions and so many mysteries she needed to find answers to. What she though to be true wasn’t and she becomes more confused and afraid. Her connection to Cole is just as angsty but there are more important things to worry about then love. The ending left me shocked and even more question! Kat is left to fight for her existence and to stop Jun Bei from making things worse. This one was a crazy ride.

Book 3:

The Vicious Cure was ten times better, the betrayal the unknown and the new information! Jun Bei is in control and we think Kat is dormant but nope, Kat is trying to make things right. But the more she uncovers the more shocked I became. Jun Bei is a morally grey character for me, she knows what she’s attempting is a good thing but she also knows she’s being unethical by doing things without consent and by force. She is her fathers daughter and we see her pull into that time and time again. But I think Kat has opened up a wall in Jun Bei shows she can be good. Kat just wants to belong, she wants a family. I was rooting for kat! I really enjoyed the third installment!
Profile Image for milly.
283 reviews24 followers
April 23, 2023
I can confidently say, that I feel like it's the best book in the trilogy. You get the character development, a lot of tension and action, and the finale itself fits just right, although I feel like at times it felt a bit tedious to read this book, and I did get a couple of thoughts to give up, but I just really wanted to know how the story would end, and now I know, and I'm happy I decided to finish this book.
Profile Image for Breanna.
607 reviews210 followers
February 29, 2020
THIS REVIEW & MORE → Paws and Paperbacks

2.5 stars ✨

This Vicious Cure was one of my most anticipated releases for the year and therefore it pains me to admit how unsatisfied and disappointed I was with the conclusion to this trilogy. I was so excited for this release that I reread the first and seconds books–something I almost never do–because I loved them so much and wanted to fully enjoy the series all over again before starting this. Now I’m think that might have been a bad idea and perhaps that’s why This Vicious Cure feels so underwhelming.

What is this book about? This Vicious Cure picks up a little bit after the end of This Cruel Design. Jun Bei is back in control of her body, after wiping the memory of everyone from the past few months, and Catarina is trapped in their mind.

What did I like? Like the previous two books, the pacing was absolutely perfect. It starts out steady from the beginning, with just the right amount of action and forward-moving plot elements that easily kept me entertained throughout the story. There were also a few clever twists. I really loved finding out the truth about Catarina and her DNA!

What didn’t I like? This Vicious Cure is set through alternating chapters told through the points of views of Jun Bei and Catarina, and I’d be lying if I said I liked the change. I was not of fan of having to read half the book from Jun Bei's character mostly because we spent the first two books not having any kind of emotional connection towards her, and that didn’t change just because she now has her own chapters. I wouldn’t have minded a few chapters from her POV thrown in between Catarina’s, but more often than not I skimmed parts of her chapters because I just didn’t care enough.

I also felt really disconnected from the other characters as well. The interactions between Catarina and Cole, Leoben, and Anna were some of my favorite aspects from the previous books, and that was something sorely missing from This Vicious Cure. And when they were together, it didn’t feel like a lot of time because the chapters would end abruptly and then jump back to Jun Bei.

And speaking of limited character interactions, the thing that was most disappointing was the complete lack of interaction between Catarina and Cole. After everything those two have been through together in the past two books, we are given one–O N E– scene with the two of them alone and having a conversation. Their feelings for each other are barely brought up, they hardly talk to each other, and their past is never touched upon. After the ending in This Cruel Design with Cole losing his memory and all their declarations of love, I was expecting……more? Instead, they exchanged probably less than fifty words throughout the book and we are given absolutely no closure for them. It honestly made me so sad and disappointed, especially since their relationship was one of my favorite parts from the series.

Overall thoughts: I would still absolute recommend this trilogy. It’s clever and unique and extremely well-written. But I wanted so much more from this conclusion than I was given, especially when everything regarding Catarina and Cole was basically swept under the rug and forgotten about.
Displaying 1 - 30 of 361 reviews