Jump to ratings and reviews
Rate this book

This Mortal Coil #2

This Cruel Design

Rate this book
In bunkers and strongholds across the world, people are celebrating. There's a vaccine to the virus that has ravaged the planet for years.

But the vaccine isn't working. The virus is evolving. Catarina - genehacker, reluctant warrior - must find the one person who can help: her estranged father, who is guilty of unimaginable crimes.

Time is ticking. She has three days before the shadowy gentech corporation Cartaxus will use lethal code to wipe out every person on the planet's surface: kill the hosts, kill the virus.

Forced to question everything she knows and everyone she trusts, and with the end approaching, Cat discovers that the biggest threat of all may be buried in her own mind.

ISBN: 0141379286
ISBN-13: 9780141379289

435 pages, Paperback

First published October 30, 2018

244 people are currently reading
6556 people want to read

About the author

Emily Suvada

7 books871 followers
Emily Suvada was born and raised in Australia, where she went on to study mathematics and astrophysics. She previously worked as a data scientist, and still spends hours writing algorithms to perform tasks which would only take minutes to complete on her own. When not writing, she can be found hiking, cycling, and conducting chemistry experiments in her kitchen. She currently lives in Portland, OR, with her family.

Ratings & Reviews

What do you think?
Rate this book

Friends & Following

Create a free account to discover what your friends think of this book!

Community Reviews

5 stars
1,685 (34%)
4 stars
2,073 (42%)
3 stars
901 (18%)
2 stars
173 (3%)
1 star
22 (<1%)
Displaying 1 - 30 of 670 reviews
Profile Image for Emily Suvada.
Author 7 books871 followers
Read
October 29, 2018
AGACAGCTTGGTCATCTCCGTACCACCTCATGACCCACATATGTATATAGGTACAGAGCACGAGTGCACTTCTCGTCGTAACCGCAAGACGGAAGGAGCCACTGTCCCTCCAAGGAAATGAGGATGTTTCCATAACTTCAGGCAACGATAGGACCTGGCCACGACGAGATCAGCGGACGCTACGTGCCTATTACGTAGTGAGGTTACGACCTGTTGTGCTAAACACGAGGATTTCATATTAGGTTGCTAGCAGGCCACGGAAGTAACTAATTTCCAGCACTGCTGGGCTGGGTAGATGCAAGTGATGTAAAC
Profile Image for patrycja ୨୧ ‧₊˚ .
185 reviews253 followers
August 10, 2025
— 3.25 ★
⊹ "sometimes memories aren't worth the pain they hold." ៹࣪
⭑𓂃 ⌗ my thoughts

wow. i'm so glad that the curse of second book didn't get "this cruel design" — it was far from being a filler book. so much was happening and when i thought everything was clear, the author decided to surprise me with another plot twist. it kept me on the edge of my seat & i was soo immersed in the world created by the author. all of it is simply brilliant. so many details that seem not to bear any importance at first, but then they all fall into place, making a perfect sense. i love catarina & cole so much, but their relationship is...quite complicated. to put it mildly—i'm still rooting for them though. if they're meant to be, they'll find they way back to each other eventually. anyway, the ending?? CRIMINAL. what happened there seems like a core part of dystopia at this point 🥲

⭑𓂃 ⌗ quotes

"I'm not...her."
"I know you're not her. you're your own person, cat. you need to hold on to that. you have to keep sight of who you are."

"that was a dark time, though, and the only light I'd been able to see was cole."

"if there is a design that underpins us, catarina, then it is cold, it is violent, and it is cruel."
Profile Image for Justine.
1,427 reviews384 followers
December 23, 2018
The sequel to This Mortal Coil picks up right where it's predecessor left off; and let me tell you, it is every bit as excellent as the first book

We continue to delve deeper into Catarina's character and all the secrets she holds, most of them from herself. The romance that barely started in the first book doesn't get much traction here given all the other dangers Catarina and Cole face, which is how it should be considering the imminent danger they continue to be in. Instead, the story focuses on the continuing conflict with the goals of Cartaxus, and trying to uncover Lachlan's whereabouts in order to make some headway on the mysteries behind his code.

What I loved about this book, among other things, is that Suvada has clearly stepped up her game in terms of both her storytelling and her craft improvement. Her worldbuilding with regards to the coding and genehacking so integral to the story remains one of my favourites using this kind of tech. Where so often authors stumble a bit after a successful debut, This Cruel Design is instead an example of all around levelling up. That makes me even more excited to read the next book, which I now have even higher expectations for.

That ending! There was tension and excitement right up to the very end, which left off in a place of so much possibility. This is a fantastic series that keeps surprising me even after I thought I had it all figured out. Just like the last one, this book is going on my favourites shelf.
Profile Image for Meredith (booksbythewater).
93 reviews22 followers
March 31, 2019
We've come full circle, kids. The first book I officially reviewed (not including one certain 4,000 word rant...ahem..The Selection) was This Mortal Coil. And here we are! One year and some months later reviewing This Cruel Design. This fact is irrelevant but there it is and now you can't unlearn it! Anyways, How do you follow up the wild ride of This Mortal Coil? I mean, it's like how they're making a Frozen 2 and a Toy Story 4 in the same year. Can we even handle that? Will they be as good as their predecessors? Time will tell on those. But as far as This Cruel Design goes, I think it stands up well compared to the thrill-ride of This Mortal Coil.

That being said, if you continued reading this series merely for Cat and Cole (which, despite given that some foreign publications were named after the main couple of the novel, I would say they aren't a big enough deal to read solely for but...to each their own.) you will probably not enjoy this second installment as much. Cat and Cole are there (obviously), but Cat has so many identity struggles and Cole gets wrapped up in so much drama and they really don't get much screen time here. At least, not enough if you're one to stick around only for the romance. That being said, the allure of this series has always been the uniquely scientific aspect of it. And in that department, while not as aptly and refreshing as TMC, Suvada did deliver. (Though not without its faults. Obviously. Because can I ever be pleased?)

What I love about the developing technology/science of this world is the discussion of craft hypothesis (as defined by the book, "...the question of whether the human form is good or if it's just what we're used to.") Suvada, thankfully, takes time to build her world less in terms of science here and more in terms of the way science has shaped the population. This isn't a conversation I would have ever thought to put in the book, but it turned out to be a crucial part of the world building and even the characterization of some people.

In addition to that, Suvada is able to take some time here in the second installment to both clear up any confusion leftover from the first novel, clarify some things, and, in true Suvada style, complicate it all once again. And, for me, that complete avoidance of second book sydrome was vital for my enjoyment of this series. While Suvada shines in originality and plot twists, her writing style itself is somewhat lacking. With recurring use of exclamation points and italics for emphasis instead of actual words that provide emphasis on their own, Suvada's writing itself is still developing. However, because she keeps her unique talent of creating a perfect blend of confusion and tension and the tiniest bit of clarity to keep the reader craving more, I can ignore the somewhat immature writing style. That being said, Suvada can't hold up a story on her writing alone (like a lot of people may argue John Green could), so the action is necessary to the plot.

This was my most anticipated release of last year and it lived up to my expectations almost in every way. I love the mystery surrounding Cat's character and I can't wait for the last book to tie everything together. I mean, Suvada will let us rest at some point, right? She's not gonna end her last book on a cliff hanger, right? Guys, I'm sweating over this. My characters are gonna get time to chill, RIGHT?! Anyway, I eagerly await the final book in this trilogy. I just know it's gonna be epic. Suvada couldn't be boring if she tried. Full circle moment over.

If there is a design that underpins us, Catarina, then it is cold, it is violent, and it is cruel.


---------------------
UHHHHH WHAT????? HOW????? IM??? SHOOK !!!!! I NEED BOOK THREE LIKE YESTERDAY

Review to come!


Before release thoughts:
Ohhhhhh, ya girl is so ready for this. I miss these characters, I'm still shook about that plot twist(s), and I'm so excited for this book. This is probably my most anticipated release of 2018- no pressure!
Profile Image for Claude's Bookzone.
1,551 reviews270 followers
March 19, 2021
CW:

Well book two continues on with incredible twists and turn in this futuristic world dominated by genetic engineering, genetic coding and a deadly virus. Quite a few 'what the heck' moments in this one and I enjoyed getting to delve deeper into the past to find out why the main characters are crucial to the survival of humanity. Totally engaging!
Profile Image for mith.
931 reviews306 followers
July 1, 2018
i have no idea what happened in this book but a lot of it was wild so i guess that's something. suvada does not fail to keep readers on their toes, that's for sure.
Profile Image for Vicky Again.
645 reviews825 followers
October 28, 2018
hey hey if you want to read Emily Suvada's awesome guest post, a THIS MORTAL COIL SURVIVAL GUIDE, you can find it here!

4 stars

Emily Suvada is honestly my favorite writer for plot twists and cliffhangers and all sorts of action-y goodness. And she totally pulled through with This Cruel Design, throwing us all sorts of twists and turns and cliffhangers (so many cliffhangers) that I just ate up.

Seriously. If you thought book 2 would be any less exciting than book 1, you're very wrong.

Although I didn't love This Cruel Design as much as I did This Mortal Coil (more on that later), the action and twists were still similarly up to par, which I know Suvada values a lot in her writing, and this definitely shows through.

Something about her writing has me flipping to the next chapter even though I know I'm supposed to be doing something else, and this makes her books so entertaining, which I love.

I do think part of the reason why I didn't love This Cruel Design as much as I did This Mortal Coil was because I was expecting to like This Cruel Design, where I walked into This Mortal Coil basically blind and hoping for something good (and something good it was).

So, the surprise factor went away, and my expectations went up with this book, which set me up to not love it as much.

It was still sooo good though.

I am still in love with all the science jargon and the way Suvada explains things makes sense, at least to me. Obviously if you're someone who's not super into science-jargon in books, then you're probably not going to like this, but if you go through This Mortal Coil relatively unscathed, then you'll be fine with this.

The science wasn't just there to be kitschy, it had actual purpose to the story, which I really liked.

Where This Cruel Design fell flat for me was honestly the characters. In book 1, I wasn't expecting as much, but with this book, I was looking for something more complex, and ultimately I feel like I didn't get that.

I do think This Cruel Design is setting us up for a lot of character stuff (especially with Catarina and [redacted]), but I didn't get that sort of interaction I desired in this book.

I enjoyed how Suvada made us question Catarina and Cole's relationship (which, I am very excited to explore this new dynamic), and this was definitely my favorite character relationship in the novel!

And also, some of the new characters were very cool (Mato, especially) and I crave more of those character juxtaposition moments.

Still, I did feel a little let down with the meager amount of character dynamics, but I also get that it was to add to the non-stop action.

Similarly, I feel like I wasn't as...horrified. I mean, first off, I've already gotten desensitized to the whole "eat a person to be immune" premise, and I guess dying and death and suffering and illness don't really faze me, which definitely could have been a result of me knowing more about these books and knowing that there was a third book in store.

Overall, though, I still gobbled up all the action and adventure and science in This Cruel Design, and definitely recommend this book and the whole series for anyone looking for a non-stop, gritty dystopia to read!

Thank you so much to Tig Wallace & Penguin UK for providing me with an advance reader's copy in exchange for an honest review!

Blog | Instagram | Twitter
Vicky Who Reads
Profile Image for Anne Goldschrift.
327 reviews411 followers
June 27, 2019
Abgebrochen auf Seite 166. Es war so abgedreht u d dabei so langweilig, dass ich entschieden habe, dass ich mich jetzt lange genug damit gequält habe. Schade, den ersten Teil fand ich toll. 😑
Profile Image for Trina.
931 reviews3,862 followers
did-not-finish
February 3, 2019
DNF at 65%.

I loved the first book but I wasn't interested in where this story went. I wasn't absorbing anything and it basically just became noise (audiobook). The character cuts off her hand and I missed it... that's probably something that you should notice.

Audiobook review: Below average. Narrator did a horrible American accent. She yells a lot, making it hard to manage the volume. I couldn't tell the difference between the character's spoken dialogue and internal thoughts because she read them in the same tone.
Profile Image for Ana.
139 reviews32 followers
April 27, 2020
3.5 stars. I’m shocked. This was pretty epic. Im so impressed with where the story went in this book. It was a wild ride. It has less than 400 pages but each and every single one is filled with tons of action and unexpected twists. It did not feel like a second book to me, it was the opposite of a filler book. However, my connection with the character was not there. Maybe the fact that not even the main characters knows who she is kind of threw me off because i felt like as the reader i didnt get her either, i felt a little detached. I kept reading because honestly the plot is fucking insane. I cant wait to see how it ends.
Profile Image for Madison.
1,088 reviews70 followers
May 31, 2018
Absolutely stunning. This Cruel Design is the epic second book in the This Mortal Coil series and it is every bit as incredible, well-written, and addictive as the first book. This Cruel Design lived up to every expectation and high standard set by its predecessor. Fast-faced and intelligent, This Cruel Design ramps up the tension and the stakes, introducing new characters and pushing the boundaries on everything once thought possible for genetics and technology.

Cat might have found a vaccine for the deadly Hydra plague, but the journey has revealed secrets that shattered her world and has left her reeling, no longer truly knowing who she is or what her purpose should be. Camping in the woods with Cole and Leoben, Cat is hoping for a chance to regroup and decide on her next move, but time is running out if she is going to prevent Lachlan from reprogramming humanity. She also needs to learn how to control her new panel and deal with the memory glitches that threaten to reveal more secrets.

This Cruel Design was one of my most anticipated reads of the year and it certainly did not disappoint. It was all too easy to fall back into the This Mortal Coil world. Not only are the plot and characters so unique that they have clearly stuck in my head since reading This Mortal Coil, but the first chapter of This Cruel Design gives a quick recap, to catch readers back up on the actions and the events that have transpired in the week since the conclusion of the first book. But readers don’t have long before being flung back into the action and constant twists and turns, and let me say that Emily Suvada really steps it up. What it takes to survive in a world bent on destruction, the fight for humanity, pushes Cat, Cole, Leo and the others to extremes. New characters are introduced, old ones reappear, and relationships become more complicated. The realms of possibility are pushed even further, with better tech and more extreme methods of coding and animal mutations like luminescent pigeons. Yet thanks to the writing style and science that underpins it all, everything feels realistic and within the grasp of our own (hopefully not, though) future, which makes it all the scarier and impactful.

This Cruel Design is sure to please fans of This Mortal Coil - it certainly made this fan very happy. While it is the second book in the series, it is by no means merely a placeholder, introducing new information and major plot twists and perfectly setting the scene for an epic third book. If you haven’t read This Mortal Coil yet, then I highly recommend it. I can’t keep it on our library shelves it’s so popular and readers reluctantly return it with exclamations and profound reviews such as “oh my god, this book is amazing.” And really, that’s all you need to know, because both book one and two are purely amazing - science fiction at its very best.

The publishers provided an advanced readers copy of this book for reviewing purposes. All opinions are my own.

Find more reviews, reading age guides, content advisory, and recommendations on my blog Madison's Library

Before reading:

This is going to be amazing!!! This Mortal Coil is one of my favourite books, and now, thanks to the publishers I am able to start reading this now. Thank you!!!!! Woooo. I’m excited.
Profile Image for Sabrina  au Barca.
273 reviews112 followers
January 22, 2020
[reread 2020]

Nothing has changed. Still one of my favourite series of all time and probably one of the best sequels to a series I've ever read.
The only thing that has changed is the fact that the third and final book sits on my shelf at this very moment, waiting for me to pick it up and to destroy my life. I think I can even hear it laughing.

[initial review]

This book clearly doesn't have the middle-book-syndrome because it might have been even better than book 1 and I need the next book or I will hunt down Emily Suvada; bind her to her chair and force her to finish the book BECAUSE

description

I swear this book didn't let me take a deep breath once and I think my sweat could form a new ocean and my heart rate while reading definitely wasn't normal but DAMN WHO CARES IF I DIE OF A HEART ATTACK THIS BOOK WAS WORTH IT OKAY

I also feel personally victimised be the sheer amazingness of this book and I really don't know if I will survive the last book
Profile Image for Jay G.
1,658 reviews445 followers
November 19, 2020
Want to see more bookish things from me? Check out my Youtube channel: https://www.youtube.com/channel/UCfer...

3.5/5 Stars

The second book in the This Mortal Coil trilogy beginning right where the first book left off.

I definitely enjoyed the first book better than this one, but it was still an enjoyable read. I liked learning more about Cat and her backstory. The writing style is very addictive, making you want to continue reading to find out more about these characters and the adventure they're embarking on. I'm still not a fan of the romance in this series, now there is a love square, rather than the triangle from the first book... Although, I suppose it is still technically a triangle since one of the love interests from the first book has dropped off. But I would have been happier if the entire romance had been left out of the story all together. I liked the introduction of the new characters. Mato, Regina and Anna were all interesting and I liked learning more about them as the story went on. I also think its interesting that Suvada used Crick, Watson and Franklin as surnames in her series, as they are big names when it comes to DNA and the double helix, I thought it was a cool inclusion to the story (I'm not sure how many people would catch onto that, I'm just a science major, lol). I didn't see the ending coming, it was a giant cliff hanger and I have no idea where the story is going to go from here, but I'm excited!
Profile Image for Aoife.
1,485 reviews650 followers
November 15, 2018
4.5 Stars

I received this book from Penguin Random House in exchange for an honest review.

This Cruel Design is the much anticipated sequel to bestselling YA dystopian This Mortal Coil which followed teenager Catarina as she tried to survive in a world where humans' bodies are ran by special, encoded tech but a virus with no cure is ravaging the world and causing people to form zombie-like habits before exploding, literally. Catarina's father is a world-renowned scientist who may be humanity's last hope but three years ago he was kidnapped by a corrupt organisation and Catarina has been on her own. Until a man calls Cole shows up claiming to be sent by her dad.

This Cruel Design follows on pretty much days after This Mortal Coil ends when Catarina, and the readers, found out something huge and the virus was continuing to evolve and get deadlier, despite desperate cure measures. I was honestly hooked into this book from the moment I started and though it took a while to get back in touch with the story and remember who everyone was, and what they were doing (I kept mixing up Dax and Cole for some reason), it didn't stop me from reading it furiously and wanting to find out what happened.

I really loved the direction this novel took - both with the world building, the new characters introduced and the slight steer away from the YA romance that was a bit too heavy in the first book. I loved that we ended up in Entropia, and saw a different style of living with more gene-hacking and tech use than where we had previously been with Catarina and Cole.I feel like the world building was better here, and though I would have liked a bit more of it, and time in Entropia, I'm confident we will see even more in the third novel.

Mato as a character was a fantastic addition for the get go, especially with the element of him being completely grey and I had no idea if I wanted to trust him or not. I also feel like I can add in Jun Bei as a new character here as well, as though we only got snippets of her in This Mortal Coil, I feel like we really began to understand her in This Cruel Design. There were definitely both human parts of her revealed to Cat, and the more dangerous side.

I wish I was a bit more tech-savvy to be able to break down how great the descriptions are of the type of tech, coding, and gene hacking used in this trilogy but unfortunately I'm not. All I can say is even for a tech dummy like me, I was able to understand what Cat and the others were doing with their tech and appreciate the gloriousness of it, and imagine a possible future where someday humans might actually have access to this kind of technology.

The end of this book, the last line (!!), was a riot and I honestly cannot wait for the next one and see what happens.
Profile Image for Shannon  Miz.
1,506 reviews1,080 followers
October 24, 2018
You can find the full review and all the fancy and/or randomness that accompanies it at It Starts at Midnight

You know that super rare feeling where a sequel is as awesome as the first book in a series? Where it doesn't suffer from that "second book slump"? Such a unicorn, right? WELL. It happens here, friends! After the amazing twistiness that was This Mortal Coil, I was kiiiind of unsure if the author could replicate such amazing plot twists and surprises. Could she keep the characters developing and still likable? She sure could, and she did!

Sequel reviews are hard, because you don't want to give away anything about the sequel of course, but nor do you want to give anything away about its predecessors. So I am going to talk, in the vaguest of terms, about the junk I loved:

•More information on the post- (and pre-) virus world. Lots of details that I was yearning for in the last book have come to light- and I know there are more to come. The author manages to give just enough information to satisfy, while still leaving you excited for whatever she throws at you next. And I love it.

•Not only is there character growth, but relationship growth. Cat has to redefine a lot of how she sees herself after the events in the last book. But she also has to transform, grow, rebuild (and in some cases, begin) lots of relationships. I loved watching how the characters navigated all the changes, and all the new things they themselves learned about their world and the people around them.

•Incredibly high stakes. It's the sort of series where no one and nothing feels safe. At any moment, the rug can be pulled out from under any character it seems, and so I was always on the edge of my seat, hoping for a good outcome, but terrified for the worst. Definitely tons of good tension.

•Again, I was so shocked by so many things in this book! Honestly, I am hard to shock at this point. So when the author somehow manages to do it over and over, and in really quality ways that make sense in the story... it's impressive, to say the least.

Bottom Line: Someone give me book 3 immediately. Please? Waiting is hard.
Profile Image for Katherine Moore.
198 reviews50 followers
March 31, 2019
My mind is blown AGAIN by Emily Suvada and her sci-fi genius. This is a stunner.


FINALLY! IT IS HERE! It’s the #bookbirthday for one of my most anticipated reads of the year, This Cruel Design, the follow-up to the brilliant This Mortal Coil (which you must read first)!

In this twisty, smart sci-fi, Cat is caught in the middle of an outbreak, struggling to find out her true identity. Find my Q&A with Emily Suvada here 👉🏼

http://kamoorephoto.booklikes.com/pos...
Profile Image for Erin.
769 reviews5 followers
November 9, 2018
This was a good follow up to the first book, but I am feeling a little disappointed with some of the directions that this book took.

Firstly - we gathered in the first book that Jun Bei and Cat are the same person, but to learn that Cat is just a creation is hard to take. Particularly since she has more humanity, kindness, and compassion than all of the other characters put together.

Secondly - two people sharing one body is problematic enough, but now there’s the love quadrangle. Is it okay to be team no one? Asking for a friend...

Thirdly - that ending, it was completely predictable. As is the fact that Cat will probably make her way back.

It was well-written, enjoyable and compelling, fast paced and action packed, with a load of revelations and a lot of science. But as so often happens in trilogies, the second book fills the spaces that the first book creates. The third book is where it’s at.
This entire review has been hidden because of spoilers.
Profile Image for Kelly.
958 reviews135 followers
March 12, 2021
A high-adrenaline follow-up to the incredible This Mortal Coil. Suvada picks up right where the first book left off and doesn't let up for 430 action-packed pages. This book is so intelligent, and every discovery Cat makes just ups the ante with more incredible twists in this virus-haunted, tech'd out dystopian world. I've never read anything quite like it.

I just wish there would have been less distance between Cole and Cat in this one. But, woohoo, welcome to the Hydra-infested arena, Jun Bei!
Profile Image for Sara (A Gingerly Review).
2,739 reviews174 followers
January 28, 2020
1/27/20: Let's continue this reread, shall we?
1/28/20: JUST AS GOOD AS I REMEMBER. GAH, I cannot wait to finish this series. <3

--------------------------

Y'all have to give me a moment to digest the depth of this story. So many revelations, so many things revealed, SO MUCH and yet I still want more.

I'm shook.

(FRTC)
Profile Image for Christine Manzari.
Author 15 books1,274 followers
August 1, 2019
Omg. That cliffhanger was brutally perfect. I only have one complaint about this book and it’s that the narrator for the audio book mispronounces a lot of words and it’s distracting. But this book was so good I easily overlooked it. My mind is blown by this plot....and especially this ending.
Profile Image for RoRo.
299 reviews74 followers
December 17, 2021
2.5 stars

Well, didn't enjoy this as much as I had hoped. Thank you @ella for this book reccomendation but I am not liking these.
This books are just extremly confusing I don't know why. I just felt that I also wasn't connecting with characters either. I will be continuting this series :/ but I really would like to see how this author is still continuing this series when I thought this book would be the ending.
Well, good night, sorry this review is very short. I am just really tired and don't feel like writing it right now. But I have time and too many reviews soooo.
BYE!
Profile Image for Rae .
301 reviews115 followers
October 13, 2018
This Cruel Design by Emily Suvada picks up where This Mortal Coil left off. With Lachlan on the run and a mutated strain of virus on the loose, it's up to Cat to save everyone above ground.

To put it quite simply: this book was SO good! I had a hard time putting it down and couldn't wait to find out what misadventures Cat and her unlikely team got into. This was a book of answers, and I was pleased to learn more about Cat, her past, her family, and her motivations. I had a lot of questions coming out of This Mortal Coil, so I was happy to have some of those questions answered.

The writing was beautiful in This Cruel Design, and the pace was quick. Cat raced against time in this book, which kept the storyline moving along swiftly.

The plot is wicked cool in this series, and I really liked the direction This Cruel Design took. Cat's backstory was a real bomb dropped, and I didn't see it coming. The storyline between Cat and Cole continued to progress, though not without some tension. I'll be curious to see where their relationship goes in the next book.

The ending of the book was a whirlwind of fast-paced action. Sides were chosen, and not everyone made it out alive. The ending also left me eagerly anticipating the next book. At this point, I have no idea what's going to happen next, but I can't wait to find out!

All of the characters in the book were delightfully written, unique and original. Some of the new characters, like Mato and Regina, added to the story nicely. Where there's good, there's bad, and Mato and Regina, both morally gray characters, were fun to get to know. Jun Bei's story also ramped up in This Cruel Design. The more I learn about Jun Bei, the more I like her character. She has a streak of compassion but all the hardness of someone who's had a really hard life.

If you like science fiction, strong characters, and lots of action, I highly recommend you check out this wonderful series!

Thank you to NetGalley for providing the Kindle version of this book in exchange for an honest review.
Profile Image for ᒪᗴᗩᕼ .
2,098 reviews191 followers
November 9, 2018
I seriously loved the first book in this series...and I almost, but not quite, loved the second book, too.  When I wrote about This Mortal Coil, I said this was completely comprehensible and seriously compelling story, especially for a book involving gene hacking, splicing, decoding and lots of technical terms and such.  I wish I could say that this book was the same for me...and it almost was, I just got a little lost in the beginning (and maybe, a little throughout)...but, eventually things started clicking for me.  The storyline goes in a direction that I didn't see coming at all and the end is kind of mind-blowing.  Almost literally, so.  All I can say is, I'm not looking forward to the wait for the third book. 

๏ ๏ ๏  MY RATING ๏ ๏ ๏ 
☆4.5☆STARS - GRADE=A-

description


๏ Breakdown of Ratings ๏ 

Plot⇝ 4.3/5
Main Characters⇝ 5/5
Secondary Characters⇝ 4.5/5 
The Feels⇝ 4.5/5
Pacing⇝ 4.5/5
Addictiveness⇝ 4.2/5
Theme or Tone⇝ 5/5
Flow (Writing Style)⇝ 4/5
Backdrop (World Building)⇝ 5/5
Originality⇝ 5/5
Ending⇝ 4.8/5 Cliffhanger⇝ Most definitely...

๏ ๏ ๏
Book Cover⇝ Explosive...
Narration⇝ ☆4.5☆ for Skye Bennett, her voice feels right for Cat.
Series⇝ This Mortal Coil #2
Setting⇝ A Futuristic United States
Source⇝ Audiobook (Library)

๏ ๏ ๏

description
Profile Image for CozyReaderKelly.
421 reviews75 followers
October 22, 2019
This series manages to both draw on previous YA dystopian novels and be completely surprising at the same time. I'll be going along feeling like the characters are carbon copies of ones from another series or that the setting feels so much like another book, but then the author will throw a bunch of reveals and twists in that make it something completely different. I can't say I loved it, but I do give her credit for throwing off the reader. I'm interested in reading the conclusion, but I doubt this will be a new favorite series.
Profile Image for Princess.
420 reviews93 followers
October 17, 2018
I received a copy of this from Edelweiss and Simon Pulse in exchange for my honest review..

Oh wow! I don't even know what to say. There were so many twists and turns and I honestly have no idea who I can trust in this book. Not even the main character. There was so much violence. How many times can 2 people almost die in this book. The story plot is exciting and I cant wait to see how it will actually end, but wow....
Profile Image for Jeann (Happy Indulgence) .
1,055 reviews6,418 followers
November 20, 2018
Filled with just as many twists and turns as the first one, This Cruel Design was another exhilarating thrill ride when it came to DNA hacking, science and viruses. I absolutely adore Emily Suvada's writing, and how she simplifies complex gene coding theories while keeping the book action-packed and character-driven.

It'd take some time to absorb my thoughts on this one, so full review to come while I catch my breath.
Profile Image for Halley Hopson.
935 reviews67 followers
February 16, 2019
4.25 stars!

This series is so incredibly action packed and full of twists and turns. I’m completely hooked.

I also would highly recommend the audiobooks, I am a big fan of the narrator for this series.
Profile Image for Kal ★ Reader Voracious.
568 reviews210 followers
January 27, 2020
"If there is a design that underpins us, Catarina,then it is cold, it is violent, and it is cruel."
One of the biggest surprises that I read in 2018 was Emily Suvada's debut novel This Mortal Coil. I've shouted about this book countless times and shoved it in the hands of many of my friends so they too could have their hearts broken experience this amazing book for themselves. My Twitter mentions are full of people screaming at me, and it brings me immense joy like the Slytherin that I am. Suffice to say that I was anxious & terrified to see what is in store next for the characters that I have come to love would be a drastic understatement.

Just when you thought everything was over, the story seems to have only just begun. The plot thickens for our group: this is a solid continuation of the series and the story is plotted intricately well. Reading the overarching storyline of the series is like a play broken down into three acts, and Suvada plotted it very well.

For those of you that have already read This Mortal Coil, you already know what to expect from Suvada's writing. The stakes have been raised and I was on the edge of my seat while reading, devouring every word as I tried to piece together what the heck was going on. I didn't know who to trust and honestly my heart couldn't take it.

I will admit that this book took a bit of time for me to settle into. I first tried to read this one shortly after publication as a This Mortal Squad buddy read, but I fell behind on the first day and waited a couple of months for my expectations to calm tf down. I picked it up again for another group read in January with Sam & Soph because I forced the series on them and now they wanted to read it with me. Huzzah! Same thing kind of happened... we all just kind of didn't prioritize reading it for about a month. But once we did find the time to all sit and read together through the first few chapters we were hooked. Even though this book has a bit slower of a start, it still brings the chapterly (is that a word? it is now) revelations and WTF bombs and the slower pacing at the beginning is worth it.

My favorite part of this installment in the trilogy is the exploration of the relationship between Leoben and Cat. Suvada is masterful with character development, and she does an excellent job in this book to bring more life and mystery to each of the characters. Everyone's shrouded in mystery and secrets. Everyone's past is a bit blurry. And I trust no one. (But I really want a t-shirt with a squid on it.)

At its core, This Cruel Design lies at a crossroads where Cat tries to figure out what makes her her and where the ethical line to genehacking and modifications lie. I love the ethical and moral dilemma of technology and science, so I really appreciated how this kind of takes center stage in the book.
"You are not your face, Catarina. You are not this body, either. I could take either of them from you, theoretically, and you would still exist. You don't have blood in your hair or broken fingernails. You don't have any hair at all. The entirety of you weighs a little over four pounds."

"If you drive a car, you don't become a car. You're always just the driver. Don't buy into the vehicle of your own flesh."
Cat is very much torn between who she believes herself to be and the person of her past that she cannot remember, and the plot is centered on that uncertainty. On whether or not the ends ever justify the means.

Overall, while the pacing of This Cruel Design was a bit slower for me to get into this was an amazing read that lived up to the glory of the first book. The stakes have been raised and our characters are all trying to do what they feel is right; right or wrong are both justified here and makes the reader question their loyalties. I absolutely love this series and will continue to shove it at everyone who will listen to me. THIS WILL BE MY LEGACY!

💥💥💥 feel free to decrypt my initial thoughts AGGCTGAAACCTCATTTGGACATGAGGCATCGATCTTAAATCGATTGTTCCACGCCACCAGGGCAGCAGAGGTACAATAATGCCACCGACGATAAGTGCGTAGGTACATTAAAGCTATAGTACATATTTCCCTGCCTGGTCTTCTCCTCGTTTGCAACAATTGAATTTAGCCAACAAGCACTAGACCAAGAAACCTTCTGATCTTTTAACGATTTCAGGACGCTTCCAACTAATCTAATAACCACATGTAGTAAATTGGATGTATGCTGCCGACGTGCGATTGATCGCACCCAGTATAGAATATTCGAGTCCTGGTGCGTTGCACCCCTCCGTGGCATCTAAAAAGCCTCCGAGCTCTAAACGAGCCGTACAATTTAGCGACTATCCTCGGCTACAAATTTCCGTGAAACCCAAGATGGCTCTCTCCGTTGGTGCGTCTAATGTATTAAGCAATGATCGCACTCAGGCTCTATAGATTTAACCTAGAGAGGTCGAGAGCTCTACTGGACGTTTGGCGAACATCTTTTAAGGTTGTAACCATGTCTGCTTGGAAGCACAAGAGCAGCCTAGGAGTACACGGAGATAGCATCACAGCACGTATGCGGTTGTTGTATATAGGAGTAGACCCATGGAACATATATGCTAGAGACCCAGCTAGGACTTCTCGTGGTATTGATAATAGGTATTCTCGACCGAACGTACATAAGAATTTTCGTCGAAACGTGATGTGCTCTGGTGGATGTGACGCTTCGAACATTTATCGTCCACTGCCGTAGATGATATTTCCGATCCTGCCTGAGACCAACCTACCTTGCATCGATCAGTCCGATCAAGGTGTAGAGCACGGAACGAACCC
Displaying 1 - 30 of 670 reviews

Can't find what you're looking for?

Get help and learn more about the design.