Jasmine
113 ratings (3.13 avg)
27 reviews

#73 best reviewers

Jasmine

Add friend
Sign in to Goodreads to learn more about Jasmine.

https://www.goodreads.com/diewolke

The Diary of a No...
Jasmine is currently reading
bookshelves: currently-reading
Rate this book
Clear rating

progress: 
 
  (page 90 of 171)
Dec 01, 2021 11:42AM

 
Loading...
Paul Celan
“I Hear that the Axe has Flowered

I hear that the axe has flowered,
I hear that the place can't be named,

I hear that the bread which looks at him
heals the hanged man,
the bread baked for him by his wife,

I hear that they call life
our only refuge.”
Paul Celan, Selected Poems

Tomihiko Morimi
“The ends of the world were inside the world when it folded in on itself.”
Tomihiko Morimi, Penguin Highway

Tomihiko Morimi
“That’s where the ends of the earth are,” he said. “Where?” “The place you think isn’t fair. You can’t do anything about it, right?”
Tomihiko Morimi, Penguin Highway

Theodor W. Adorno
“Life has become the ideology of its own absence.”
Theodor W. Adorno, Minima Moralia: Reflections on a Damaged Life

Nick Land
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

220 Goodreads Librarians Group — 329190 members — last activity 3 minutes ago
Goodreads Librarians are volunteers who help ensure the accuracy of information about books and authors in the Goodreads' catalog. The Goodreads Libra ...more
67886 /lit/ (2025 revival edition) — 1280 members — last activity Jun 24, 2026 04:00AM
No fun allowed. Reading top 100 books from the /lit/ chart.
1097487 Corpus Linguistics Reading Group @UMass Boston — 6 members — last activity Aug 11, 2020 09:20PM
A reading group for applied linguistics students interested in reading and researching the topic of corpus linguistics. We're interested in both eleme ...more
62603 Books2Movies Club — 2499 members — last activity May 01, 2023 11:36AM
Have you read the book, seen the movie, neither – but you are eager to read and see both? Then this is absolutely perfect group for you! We like to se ...more
82419 Eastern European Literature — 65 members — last activity Sep 03, 2017 05:59AM
Everything from the Alexander Radishchev's "Journey from St. Petersburg to Moscow" to Dorota Masłowska's "White and Red." This group is for anyone who ...more
More of Jasmine’s groups…
year in books
Lee
Lee
5,228 books | 107 friends

Aung Se...
1,925 books | 284 friends

Osiris ...
35,187 books | 272 friends

Mark Da...
3,084 books | 170 friends

Thant T...
175 books | 31 friends

David S...
254 books | 6 friends

melanch...
495 books | 160 friends

Ian
Ian
524 books | 168 friends

More friends…



Polls voted on by Jasmine

Lists liked by Jasmine