Jasmine

“Every film is political. Most political of all are those that pretend not to
be: 'entertainment' movies. They are the most political films there are
because they dismiss the possibility of change. In every frame they tell
you everything's fine the way it is. They are a continual advertisement for
things as they are.”
― Wim Wenders

“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

“I Hear that the Axe has Flowered

I hear that the axe has flowered,
I hear that the place can't be named,

I hear that the bread which looks at him
heals the hanged man,
the bread baked for him by his wife,

I hear that they call life
our only refuge.”
― Paul Celan, Selected Poems

“Life has become the ideology of its own absence.”
― Theodor W. Adorno, Minima Moralia: Reflections on a Damaged Life