Jasmine
113 ratings (3.13 avg)
27 reviews

#73 best reviewers

Jasmine

Add friend
Sign in to Goodreads to learn more about Jasmine.

https://www.goodreads.com/diewolke

The Diary of a No...
Jasmine is currently reading
bookshelves: currently-reading
Rate this book
Clear rating

progress: 
 
  (page 90 of 171)
Dec 01, 2021 11:42AM

 
Loading...
Tomihiko Morimi
“Terayama Shuuji once said “Throw away your books, rally in the streets”.
But back then, I thought — rally in the streets, and then what?”
Tomihiko Morimi, 四畳半神話大系

Wim Wenders
“Every film is political. Most political of all are those that pretend not to
be: 'entertainment' movies. They are the most political films there are
because they dismiss the possibility of change. In every frame they tell
you everything's fine the way it is. They are a continual advertisement for
things as they are.”
Wim Wenders

Wim Wenders
“I dislike the manipulation that's necessary to press all the images of a
film into one story; it's very harmful for the images because it tends to
drain them of their 'life'. In the relationship between story and image, I
see the story as a kind of vampire, trying to suck all the blood from an
image. Images are acutely sensitive; like snails they shrink back when you
touch their horns. They don't have it in them to be carthorses: carrying
and transporting messages or significance or intention or a moral. But
that's precisely what a story wants from them.”
Wim Wenders

Theodor W. Adorno
“Life has become the ideology of its own absence.”
Theodor W. Adorno, Minima Moralia: Reflections on a Damaged Life

Nick Land
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

220 Goodreads Librarians Group — 316461 members — last activity 0 minutes ago
Goodreads Librarians are volunteers who help ensure the accuracy of information about books and authors in the Goodreads' catalog. The Goodreads Libra ...more
67886 /lit/ (2025 revival edition) — 1281 members — last activity Feb 16, 2026 03:26AM
No fun allowed. Reading top 100 books from the /lit/ chart.
1097487 Corpus Linguistics Reading Group @UMass Boston — 7 members — last activity Aug 11, 2020 09:20PM
A reading group for applied linguistics students interested in reading and researching the topic of corpus linguistics. We're interested in both eleme ...more
62603 Books2Movies Club — 2499 members — last activity May 01, 2023 11:36AM
Have you read the book, seen the movie, neither – but you are eager to read and see both? Then this is absolutely perfect group for you! We like to se ...more
82419 Eastern European Literature — 65 members — last activity Sep 03, 2017 05:59AM
Everything from the Alexander Radishchev's "Journey from St. Petersburg to Moscow" to Dorota Masłowska's "White and Red." This group is for anyone who ...more
More of Jasmine’s groups…
year in books
David S...
233 books | 6 friends

Osiris ...
22,431 books | 269 friends

Thant T...
196 books | 30 friends

Aung Se...
1,832 books | 281 friends

Lee
Lee
4,953 books | 108 friends

Malachy
780 books | 56 friends

Limey
3,052 books | 166 friends

melanch...
466 books | 158 friends

More friends…



Polls voted on by Jasmine

Lists liked by Jasmine